Incidental Mutation 'R2057:Snrpn'
ID228259
Institutional Source Beutler Lab
Gene Symbol Snrpn
Ensembl Gene ENSMUSG00000102252
Gene Namesmall nuclear ribonucleoprotein N
Synonyms2410045I01Rik, Peg4, Pwcr1
MMRRC Submission 040062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R2057 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location59982495-60140219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59987456 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 37 (H37Q)
Ref Sequence ENSEMBL: ENSMUSP00000096003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059305] [ENSMUST00000098402] [ENSMUST00000179360] [ENSMUST00000189432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059305
AA Change: H37Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055941
Gene: ENSMUSG00000102252
AA Change: H37Q

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098402
AA Change: H37Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096003
Gene: ENSMUSG00000102252
AA Change: H37Q

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179360
SMART Domains Protein: ENSMUSP00000136053
Gene: ENSMUSG00000000948

DomainStartEndE-ValueType
Pfam:SNURF 1 70 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189432
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is one polypeptide of a small nuclear ribonucleoprotein complex, and it plays a role in pre-mRNA processing. Although individual snRNPs are believed to recognize specific nucleic acid sequences through RNA-RNA base pairing, the specific role of this family member is unknown. This protein arises from a bicistronic transcript that also encodes a protein identified as the Snrpn upstream reading frame (Snurf). Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region. Additional splice variants have been described but sequences for the complete transcripts have not been determined. The 5' UTR of this gene has been identified as an imprinting center. Alternative splicing or deletion caused by a translocation event in this paternally-expressed region in human and mouse is responsible for Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted intragenic deletions are phenotypically normal. Deletions that also encompass neighboring genes on the paternal chromosome exhibit growth retardation, hypotonia, and high mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G A 6: 41,032,381 T173I probably benign Het
Abcc2 A G 19: 43,818,038 K764E probably damaging Het
Abcg2 T C 6: 58,690,540 V129A probably benign Het
Adgrf5 A G 17: 43,428,586 Y72C possibly damaging Het
Ago1 C T 4: 126,443,228 R228H probably damaging Het
Ano1 A G 7: 144,648,052 V334A probably damaging Het
Apob A T 12: 8,002,164 R1202* probably null Het
Arfgap3 G T 15: 83,310,300 D389E probably benign Het
Atf6b A T 17: 34,648,575 probably null Het
Atoh8 T C 6: 72,235,128 K13E probably damaging Het
Bicral G T 17: 46,824,888 N465K possibly damaging Het
Bves T A 10: 45,343,135 Y110N probably damaging Het
C4b A G 17: 34,728,620 Y1695H probably damaging Het
Cage1 A G 13: 38,023,380 V163A probably benign Het
Canx T C 11: 50,304,425 N272S probably damaging Het
Caskin1 G T 17: 24,496,459 G93V probably damaging Het
Cd34 T C 1: 194,959,142 V292A probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdh16 C A 8: 104,621,965 G144* probably null Het
Chaf1b T A 16: 93,894,907 H280Q probably damaging Het
Chpf2 G A 5: 24,591,222 G389R probably damaging Het
Crb1 T C 1: 139,314,750 Y330C probably damaging Het
Cux2 A T 5: 121,869,504 V698E probably benign Het
Dhtkd1 A G 2: 5,942,619 V18A unknown Het
Dmbt1 G A 7: 131,106,170 A1381T possibly damaging Het
Enpp1 C G 10: 24,660,192 A437P probably damaging Het
Fat2 C T 11: 55,281,860 V2676I possibly damaging Het
Fzd2 A G 11: 102,605,933 D401G probably damaging Het
Gcm2 T C 13: 41,109,954 M1V probably null Het
Gnai3 C T 3: 108,112,496 V233I probably benign Het
Golim4 T A 3: 75,894,887 D366V possibly damaging Het
Grin1 T A 2: 25,316,820 T110S probably damaging Het
Grin2a A G 16: 9,669,744 V430A probably benign Het
Gstp3 G A 19: 4,059,282 T5I probably damaging Het
Il17rb T A 14: 29,997,154 M324L probably benign Het
Jmy A G 13: 93,459,703 Y473H probably damaging Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Kremen2 T C 17: 23,742,717 E272G possibly damaging Het
Lmo7 G C 14: 101,887,178 A358P probably damaging Het
Mdh1b T C 1: 63,721,582 I107V probably benign Het
Mlkl T C 8: 111,333,610 Q48R probably benign Het
Myh2 G A 11: 67,188,839 probably null Het
Naip1 T A 13: 100,425,573 Q1028L probably damaging Het
Ncald T A 15: 37,397,179 I86F possibly damaging Het
Nid1 A C 13: 13,500,473 H926P probably benign Het
Nlrp9a T A 7: 26,557,362 I46K possibly damaging Het
Olfr59 A G 11: 74,288,826 Y60C probably damaging Het
Olfr823 A T 10: 130,111,990 S267T probably benign Het
Pak1 T A 7: 97,907,797 probably null Het
Parpbp T A 10: 88,124,962 M221L probably benign Het
Pde12 T C 14: 26,668,880 I225V probably benign Het
Phf19 G T 2: 34,899,608 R367S probably benign Het
Plcl2 A G 17: 50,668,111 probably null Het
Plxnb1 A T 9: 109,109,226 I1283F possibly damaging Het
Pramel6 T A 2: 87,508,715 N86K possibly damaging Het
Prkdc A G 16: 15,727,605 T1862A probably benign Het
Prpf40a A T 2: 53,144,839 I779K probably damaging Het
Ptpn20 A T 14: 33,630,985 E227V probably damaging Het
Rad54b C T 4: 11,606,088 R499C probably benign Het
Rarg C A 15: 102,239,504 A291S probably damaging Het
Rnf169 A T 7: 99,925,408 L660Q probably damaging Het
Scn4a A G 11: 106,335,724 V670A probably damaging Het
Serpinb9c A T 13: 33,156,871 C81* probably null Het
Sik1 A G 17: 31,848,797 S435P probably benign Het
Slc35g2 G A 9: 100,553,276 A114V probably damaging Het
Slc7a14 A T 3: 31,237,496 V211E probably damaging Het
Spock3 T A 8: 63,245,170 C185* probably null Het
Tbc1d4 A G 14: 101,477,155 S627P probably damaging Het
Tgoln1 T C 6: 72,615,670 T276A probably benign Het
Tmem176b G A 6: 48,836,333 T64I probably damaging Het
Tnpo2 T C 8: 85,050,113 L483P probably damaging Het
Tpte T A 8: 22,318,339 D163E probably benign Het
Trim36 A T 18: 46,196,162 D70E probably benign Het
Umodl1 G A 17: 31,008,766 probably null Het
Wdr90 T C 17: 25,855,199 T691A probably benign Het
Zdhhc8 A G 16: 18,228,346 S118P probably damaging Het
Zfp438 T C 18: 5,214,085 E291G probably benign Het
Zfp879 C T 11: 50,832,601 E543K probably benign Het
Other mutations in Snrpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Snrpn APN 7 59987446 missense possibly damaging 0.80
IGL03349:Snrpn APN 7 59985865 missense probably damaging 0.99
R0032:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R1789:Snrpn UTSW 7 59983459 utr 3 prime probably benign
R4621:Snrpn UTSW 7 59987526 missense possibly damaging 0.84
R7600:Snrpn UTSW 7 59988603 start codon destroyed probably null 0.61
R7664:Snrpn UTSW 7 59987491 missense probably benign 0.15
R8183:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R8250:Snrpn UTSW 7 59986885 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAATGGCTATGATGCAATG -3'
(R):5'- ACTTTAAGGTTCTGAGAAGTGTCG -3'

Sequencing Primer
(F):5'- GCTATGATGCAATGTAAGGATTTGAC -3'
(R):5'- TTGGCAGACTGTGGGTAA -3'
Posted On2014-09-17