Incidental Mutation 'R4808:Oprd1'
ID370817
Institutional Source Beutler Lab
Gene Symbol Oprd1
Ensembl Gene ENSMUSG00000050511
Gene Nameopioid receptor, delta 1
SynonymsDOR, mDOR, Nbor, DOR-1
MMRRC Submission 042427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4808 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132110726-132144486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132117394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 101 (T101M)
Ref Sequence ENSEMBL: ENSMUSP00000050077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056336]
PDB Structure
Structure of the delta opioid receptor bound to naltrindole [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056336
AA Change: T101M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050077
Gene: ENSMUSG00000050511
AA Change: T101M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 58 288 8.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 60 333 1.7e-11 PFAM
Pfam:7tm_1 66 318 4e-58 PFAM
Pfam:7TM_GPCR_Srv 69 335 3.7e-9 PFAM
Meta Mutation Damage Score 0.5328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele do not develop analgesic tolerance to morphine while mice homozygous for a different knock-out allele exhibit hyperactivity, increased anxiety, and decreased coping response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
Abi3bp A G 16: 56,594,516 D347G probably damaging Het
Adora2a A G 10: 75,333,446 N248S probably damaging Het
Agap3 T C 5: 24,501,245 F836L probably benign Het
Arap2 G A 5: 62,730,641 T454M probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atm A G 9: 53,445,495 S2819P probably damaging Het
Atp8b1 A G 18: 64,561,711 F500S probably benign Het
Catsper1 G A 19: 5,344,136 D682N possibly damaging Het
Ccdc105 A T 10: 78,752,864 D37E probably benign Het
Chordc1 A G 9: 18,292,413 Y6C probably damaging Het
Cped1 A G 6: 22,088,757 K273R probably damaging Het
Crat T C 2: 30,410,021 I116V probably benign Het
Cyp26a1 A G 19: 37,701,125 H423R probably benign Het
Cyp4f40 A G 17: 32,674,275 E360G probably benign Het
D430041D05Rik A C 2: 104,201,110 probably null Het
Eif3i A T 4: 129,592,064 F323I probably benign Het
Fam53a A G 5: 33,607,679 S228P probably damaging Het
Gm10305 C T 4: 99,273,244 noncoding transcript Het
Gm7347 C T 5: 26,054,997 R185H probably benign Het
Golga2 G T 2: 32,303,214 A441S probably benign Het
Gphn T A 12: 78,654,880 S608T probably benign Het
Gramd1b A T 9: 40,304,349 V620E possibly damaging Het
H2-M9 T C 17: 36,640,792 T264A probably damaging Het
Hist2h2bb T G 3: 96,270,013 S88A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd3b6 G A 3: 98,806,285 H233Y probably damaging Het
Ighv6-7 T A 12: 114,455,721 R88* probably null Het
Jup C T 11: 100,378,192 R465H probably damaging Het
Kif16b A T 2: 142,857,358 Y101N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mapkap1 G A 2: 34,597,422 probably null Het
Myocos T C 1: 162,657,040 probably benign Het
Nav1 C T 1: 135,455,204 G1197S probably damaging Het
Oas1g T G 5: 120,879,322 K223T possibly damaging Het
Olfr293 A G 7: 86,663,938 D92G probably benign Het
Olfr577 T C 7: 102,973,911 H27R probably damaging Het
Pcdha7 G A 18: 36,974,228 C102Y probably damaging Het
Pcx T A 19: 4,620,928 S1086T probably benign Het
Pde8a A G 7: 81,282,931 T114A probably benign Het
Pias4 A G 10: 81,155,840 probably null Het
Pkn3 G A 2: 30,090,081 G750E probably damaging Het
Pramel5 G A 4: 144,272,755 A254V probably benign Het
Ptprq A G 10: 107,718,507 L119P probably damaging Het
Rasgrf2 A T 13: 92,023,682 L395Q probably damaging Het
Rbm19 T C 5: 120,118,774 S51P probably damaging Het
Rfx5 A G 3: 94,958,280 T297A probably benign Het
Scaf1 T C 7: 45,008,639 E272G probably damaging Het
Slc24a2 G T 4: 87,032,238 Q396K probably benign Het
Slc39a14 T C 14: 70,315,801 I162V probably damaging Het
Snap25 A G 2: 136,770,102 D70G probably damaging Het
Spata31d1b C T 13: 59,715,721 P228S probably benign Het
Sppl3 T A 5: 115,083,426 probably benign Het
Sspo A G 6: 48,451,161 D314G probably damaging Het
Steap1 G T 5: 5,738,829 probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Uap1l1 A G 2: 25,362,085 S473P probably damaging Het
Xpo5 T A 17: 46,235,970 N882K probably benign Het
Zfp536 A T 7: 37,479,305 C228S probably damaging Het
Other mutations in Oprd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02825:Oprd1 APN 4 132117359 missense probably damaging 0.96
IGL03030:Oprd1 APN 4 132117385 missense possibly damaging 0.94
R0066:Oprd1 UTSW 4 132113988 missense probably benign 0.00
R0403:Oprd1 UTSW 4 132113768 missense probably benign 0.18
R1857:Oprd1 UTSW 4 132113681 missense probably damaging 1.00
R5176:Oprd1 UTSW 4 132113793 missense probably benign 0.34
R5693:Oprd1 UTSW 4 132144410 start gained probably benign
R5957:Oprd1 UTSW 4 132144163 missense probably benign 0.02
R6264:Oprd1 UTSW 4 132114054 missense possibly damaging 0.78
R6896:Oprd1 UTSW 4 132117301 missense probably damaging 0.97
R7205:Oprd1 UTSW 4 132113801 missense probably damaging 1.00
R7417:Oprd1 UTSW 4 132117452 missense probably damaging 1.00
R7426:Oprd1 UTSW 4 132114067 missense probably benign 0.02
R7480:Oprd1 UTSW 4 132117181 missense possibly damaging 0.92
R7552:Oprd1 UTSW 4 132113781 missense possibly damaging 0.80
Z1177:Oprd1 UTSW 4 132113729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACTGCCATGACCATGATG -3'
(R):5'- CCTTTGTCGATCTTTGAGCAAG -3'

Sequencing Primer
(F):5'- GCATATATTGATCAGCTTGGCC -3'
(R):5'- GATCTTTGAGCAAGTCCCTTCAC -3'
Posted On2016-02-04