Incidental Mutation 'R4827:Olfr536'
ID372503
Institutional Source Beutler Lab
Gene Symbol Olfr536
Ensembl Gene ENSMUSG00000052508
Gene Nameolfactory receptor 536
SynonymsGA_x6K02T2PBJ9-42653501-42652578, MOR252-1, MOR252-4
MMRRC Submission 042443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4827 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140500849-140507396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 140503670 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 263 (L263R)
Ref Sequence ENSEMBL: ENSMUSP00000149758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064392] [ENSMUST00000209873] [ENSMUST00000215340] [ENSMUST00000215768]
Predicted Effect probably damaging
Transcript: ENSMUST00000064392
AA Change: L263R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067699
Gene: ENSMUSG00000052508
AA Change: L263R

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 8.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 5.4e-6 PFAM
Pfam:7tm_1 41 289 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211326
Predicted Effect probably damaging
Transcript: ENSMUST00000215340
AA Change: L263R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215768
AA Change: L263R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A C 6: 50,595,856 S26A possibly damaging Het
4931408C20Rik T C 1: 26,685,842 K86E possibly damaging Het
Adck1 A G 12: 88,446,719 R274G probably benign Het
Agbl5 T G 5: 30,895,814 S83R probably damaging Het
Ankib1 A G 5: 3,701,907 I711T probably damaging Het
Arnt T A 3: 95,489,913 probably null Het
Atad2 C G 15: 58,108,348 V702L probably benign Het
B4galnt4 A G 7: 141,068,479 E636G probably benign Het
Btbd2 A G 10: 80,646,389 I244T probably damaging Het
Cenpc1 A T 5: 86,034,431 N531K possibly damaging Het
Ces3b T A 8: 105,086,895 M266K probably benign Het
Cfap54 A T 10: 92,902,075 probably benign Het
Coq8a A G 1: 180,167,338 V590A possibly damaging Het
Drc7 A G 8: 95,071,639 Y504C probably damaging Het
Elovl4 T C 9: 83,806,038 M1V probably null Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fads2 A G 19: 10,082,594 F239L probably benign Het
Gcc2 A T 10: 58,286,131 probably null Het
Ggact C T 14: 122,891,575 R76H probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3739 A T 14: 7,300,349 F13I probably damaging Het
Gm6768 C T 12: 119,261,794 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 T C 14: 19,875,830 K65E possibly damaging Het
Gnmt A G 17: 46,727,319 Y94H possibly damaging Het
Gzme C A 14: 56,119,298 R69M probably null Het
Hdc G A 2: 126,594,313 P546L probably benign Het
Ibtk C A 9: 85,728,554 V326F probably benign Het
Inpp5b G T 4: 124,743,850 probably benign Het
Kcnh7 A T 2: 62,716,220 C1006S probably benign Het
Kcnk18 A T 19: 59,219,930 N66I probably damaging Het
Lpar6 T A 14: 73,238,750 N50K probably damaging Het
Lrba G T 3: 86,360,150 D1716Y possibly damaging Het
Ltf T A 9: 111,027,377 probably benign Het
Map3k6 A G 4: 133,248,849 T794A possibly damaging Het
Mcm8 A G 2: 132,823,254 T217A probably damaging Het
Meaf6 A G 4: 125,102,920 E141G probably damaging Het
Mmp13 A G 9: 7,278,880 T324A possibly damaging Het
Msl2 T G 9: 101,102,151 F575V probably benign Het
Nlrp2 A T 7: 5,328,951 W149R possibly damaging Het
Ntng1 C A 3: 110,135,411 C33F probably damaging Het
Nxn A G 11: 76,261,592 Y359H probably benign Het
Olfml2a A C 2: 38,960,021 D583A probably damaging Het
Olfr1272 A T 2: 90,282,203 I124N probably damaging Het
Olfr330 A G 11: 58,529,596 I130T probably damaging Het
Olfr392 A T 11: 73,814,721 Y120* probably null Het
Olfr616 A T 7: 103,564,545 S245T probably damaging Het
Pcdha4 T C 18: 36,953,198 S145P probably damaging Het
Pcsk2 A T 2: 143,801,179 K459* probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Plch2 A G 4: 154,991,113 F653S probably damaging Het
Plpp3 T C 4: 105,230,970 I296T probably benign Het
Polr2b A G 5: 77,342,551 E846G probably benign Het
Ptpro A T 6: 137,442,710 N157Y probably damaging Het
Ralgapa1 A G 12: 55,676,437 L1815P probably damaging Het
Sap18 A G 14: 57,798,563 N69D probably damaging Het
Sncg C A 14: 34,373,327 V74F probably damaging Het
Tmem186 A T 16: 8,635,817 Y193* probably null Het
Trrap A G 5: 144,800,948 S1045G probably benign Het
Tti2 T G 8: 31,150,970 S41A probably benign Het
Unc13c T C 9: 73,931,286 E761G probably damaging Het
Vamp2 T A 11: 69,089,811 D68E probably benign Het
Vmn1r200 A T 13: 22,395,095 M14L probably benign Het
Vps35 T A 8: 85,273,557 D480V possibly damaging Het
Zfp462 T C 4: 55,012,213 L1393P probably damaging Het
Zfp512 G A 5: 31,472,814 M274I probably benign Het
Znfx1 C G 2: 167,044,231 G803A possibly damaging Het
Other mutations in Olfr536
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr536 APN 7 140504184 missense probably damaging 1.00
IGL02065:Olfr536 APN 7 140504164 missense probably benign 0.02
IGL02812:Olfr536 APN 7 140503620 missense probably damaging 0.99
IGL02896:Olfr536 APN 7 140504055 splice site probably null
IGL03281:Olfr536 APN 7 140503800 missense probably damaging 1.00
R2440:Olfr536 UTSW 7 140503552 missense probably benign 0.25
R3110:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R3112:Olfr536 UTSW 7 140503919 missense probably damaging 0.99
R4349:Olfr536 UTSW 7 140504357 nonsense probably null
R4660:Olfr536 UTSW 7 140504020 missense probably benign 0.03
R5606:Olfr536 UTSW 7 140503800 missense probably damaging 1.00
R5607:Olfr536 UTSW 7 140504405 missense probably benign 0.10
R7102:Olfr536 UTSW 7 140504316 missense probably benign 0.05
R7354:Olfr536 UTSW 7 140504186 missense probably damaging 1.00
R8081:Olfr536 UTSW 7 140504456 start codon destroyed probably null 1.00
R8095:Olfr536 UTSW 7 140504279 missense probably damaging 1.00
R8520:Olfr536 UTSW 7 140504402 missense probably benign 0.14
Z1088:Olfr536 UTSW 7 140503805 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCGGAGTCAGATGTTACAG -3'
(R):5'- AGACATGTTCCTGACAGGCC -3'

Sequencing Primer
(F):5'- AAAGGAAGGTTTCAGTGATCCCTTG -3'
(R):5'- ATGTTCCTGACAGGCCTGAAC -3'
Posted On2016-03-01