Incidental Mutation 'R4862:Olfr1094'
ID374583
Institutional Source Beutler Lab
Gene Symbol Olfr1094
Ensembl Gene ENSMUSG00000044213
Gene Nameolfactory receptor 1094
SynonymsGA_x6K02T2Q125-48321457-48322449, MOR179-7
MMRRC Submission 043260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4862 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86824663-86830282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86829532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 260 (V260E)
Ref Sequence ENSEMBL: ENSMUSP00000148902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105211] [ENSMUST00000217509]
Predicted Effect probably damaging
Transcript: ENSMUST00000105211
AA Change: V260E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100846
Gene: ENSMUSG00000044213
AA Change: V260E

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 4.6e-52 PFAM
Pfam:7tm_1 53 316 3.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217509
AA Change: V260E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2990 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T G 6: 41,032,411 D163A possibly damaging Het
5330417C22Rik A G 3: 108,467,833 S573P probably benign Het
Acox3 A G 5: 35,589,739 T167A probably benign Het
Aox1 T G 1: 58,095,157 D1096E probably damaging Het
Arid4a A T 12: 71,075,947 D1034V probably damaging Het
Chaf1b T A 16: 93,887,134 L91Q probably damaging Het
Copb2 G T 9: 98,581,267 D512Y probably damaging Het
Daam1 A G 12: 71,942,207 E127G unknown Het
Dhx16 A G 17: 35,883,262 I422V probably benign Het
Dnah6 C T 6: 73,121,788 V2043I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync2h1 A G 9: 7,147,717 V971A probably benign Het
Elmo1 A G 13: 20,449,512 H448R probably benign Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gm8251 G A 1: 44,058,018 P1307S possibly damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Igkv6-13 C A 6: 70,457,781 V27L probably benign Het
Krt28 A T 11: 99,365,110 I441N possibly damaging Het
Lgr5 A T 10: 115,462,764 D286E probably damaging Het
Mapkap1 A G 2: 34,623,430 Y448C probably damaging Het
Olfr453 T C 6: 42,744,555 Y173H possibly damaging Het
Ppt1 A C 4: 122,844,449 N89T probably damaging Het
Ptgs1 G T 2: 36,237,255 R51L probably damaging Het
Slc47a2 A G 11: 61,313,694 F277S possibly damaging Het
Smcr8 A G 11: 60,778,071 E15G probably benign Het
Tbce A G 13: 13,998,419 S476P possibly damaging Het
Tmem131l A T 3: 83,898,210 probably benign Het
Unc5c T C 3: 141,789,773 Y468H probably damaging Het
Ush1c A T 7: 46,229,240 L117H probably damaging Het
Wdfy4 A G 14: 33,100,903 probably null Het
Zfa-ps G T 10: 52,543,096 noncoding transcript Het
Zfat C A 15: 68,180,110 A605S probably benign Het
Zfp853 T A 5: 143,289,661 Q68L unknown Het
Zfyve16 G A 13: 92,508,256 T1146I probably damaging Het
Other mutations in Olfr1094
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Olfr1094 APN 2 86829368 missense probably benign
IGL03053:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL03168:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL02799:Olfr1094 UTSW 2 86828956 missense probably damaging 0.99
R0511:Olfr1094 UTSW 2 86829606 missense probably benign 0.02
R0944:Olfr1094 UTSW 2 86828937 missense probably benign 0.01
R1065:Olfr1094 UTSW 2 86829544 missense probably damaging 0.98
R1476:Olfr1094 UTSW 2 86829198 missense probably benign 0.31
R1807:Olfr1094 UTSW 2 86829101 missense probably benign 0.03
R2865:Olfr1094 UTSW 2 86828854 missense probably benign 0.21
R2915:Olfr1094 UTSW 2 86829226 missense probably benign 0.02
R3055:Olfr1094 UTSW 2 86829127 missense possibly damaging 0.94
R3104:Olfr1094 UTSW 2 86829691 missense probably benign 0.03
R4874:Olfr1094 UTSW 2 86829254 missense probably damaging 0.98
R5505:Olfr1094 UTSW 2 86829501 missense possibly damaging 0.88
R5507:Olfr1094 UTSW 2 86829317 missense probably damaging 1.00
R6318:Olfr1094 UTSW 2 86829654 missense possibly damaging 0.73
R6538:Olfr1094 UTSW 2 86829525 missense possibly damaging 0.55
R8058:Olfr1094 UTSW 2 86829708 missense probably benign 0.01
R8285:Olfr1094 UTSW 2 86829099 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGCATGTCTTCTGTGATATTCC -3'
(R):5'- AACATTTTAGAACATGGCCACC -3'

Sequencing Primer
(F):5'- GCTTGCTATTTCTTGTTCAAACAC -3'
(R):5'- TTTAGAACATGGCCACCATTAAC -3'
Posted On2016-03-17