Mutagenetix > Incidental Mutation

Incidental Mutation 'R4386:Usp5'

377704

Institutional Source

Beutler Lab

Gene Symbol

Usp5

Ensembl Gene

ENSMUSG00000038429

Gene Name

ubiquitin specific peptidase 5 (isopeptidase T)

Synonyms

Ucht

MMRRC Submission

041680-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4386 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124815019-124829484 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 124818474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000041299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000172132]

AlphaFold

P56399

Predicted Effect

probably null
Transcript: ENSMUST00000047510

SMART Domains

Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	656	694	3.12e-7	SMART
UBA	724	761	8.63e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122110

SMART Domains

Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-19	BLAST
ZnF_UBP	198	253	6.47e-27	SMART
low complexity region	497	516	N/A	INTRINSIC
UBA	633	671	3.12e-7	SMART
UBA	701	738	8.63e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141042

Predicted Effect

probably benign
Transcript: ENSMUST00000142058

SMART Domains

Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Blast:ZnF_UBP	29	78	4e-20	BLAST
ZnF_UBP	180	235	6.47e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154189

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154883

Predicted Effect

probably benign
Transcript: ENSMUST00000172132

SMART Domains

Protein: ENSMUSP00000130858
Gene: ENSMUSG00000023456

Domain	Start	End	E-Value	Type
Pfam:TIM	57	295	9.2e-86	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204602

Meta Mutation Damage Score

0.9498

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,241,921		probably null	Het
Acsm3	G	T	7: 119,773,871	W199L	probably damaging	Het
Arap1	T	A	7: 101,385,571	D236E	probably benign	Het
Arhgap1	T	C	2: 91,668,237	Y160H	probably damaging	Het
Arid1b	A	G	17: 4,994,972		probably benign	Het
Cdc25a	A	G	9: 109,889,733	E334G	probably damaging	Het
Ciz1	C	T	2: 32,370,099	T219M	possibly damaging	Het
Cluap1	A	C	16: 3,933,722	D315A	possibly damaging	Het
Cps1	T	C	1: 67,170,995		probably null	Het
Cul2	T	C	18: 3,434,856	S668P	probably damaging	Het
Fah	T	A	7: 84,599,136	T125S	probably damaging	Het
Fam129c	A	G	8: 71,607,511		probably benign	Het
Fam221a	G	A	6: 49,378,432	C156Y	probably damaging	Het
Gm6158	G	T	14: 24,070,294		noncoding transcript	Het
Hbq1b	T	A	11: 32,287,295	V63E	probably damaging	Het
Ighv6-5	G	A	12: 114,416,717	T79I	possibly damaging	Het
Kif12	G	A	4: 63,171,218	T99M	probably damaging	Het
Kif1a	T	A	1: 93,068,550	K298M	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lama1	A	G	17: 67,773,712	Q1245R	probably benign	Het
March4	G	A	1: 72,428,814	P353L	probably benign	Het
Nadk	A	T	4: 155,582,575		probably benign	Het
Ncoa2	T	C	1: 13,177,165	T345A	probably damaging	Het
Nsun6	T	A	2: 14,996,522	M408L	probably benign	Het
Nuak1	T	A	10: 84,394,044	E155V	probably damaging	Het
Olfr1395	T	A	11: 49,149,015	Y253N	probably damaging	Het
Olfr157	C	T	4: 43,836,124	R122H	probably benign	Het
Olfr291	T	C	7: 84,856,548	Y60H	probably damaging	Het
Olfr510	T	A	7: 108,668,253	V279E	probably damaging	Het
Oosp1	C	T	19: 11,667,794	V169I	possibly damaging	Het
Pabpc2	T	C	18: 39,775,185	V501A	probably benign	Het
Pik3c2a	A	G	7: 116,354,099	V1187A	probably damaging	Het
Pkhd1	A	G	1: 20,414,292	V2013A	probably benign	Het
Psmd1	T	A	1: 86,128,192	S759T	possibly damaging	Het
Scgb1b2	T	A	7: 31,290,664	K86N	possibly damaging	Het
Sdk1	T	C	5: 142,094,626	I1291T	probably damaging	Het
Skint5	T	C	4: 113,483,893	Y1396C	probably benign	Het
Slc24a3	A	G	2: 145,606,826	E380G	probably benign	Het
Spock1	A	G	13: 57,440,450	S270P	probably damaging	Het
Tmem128	T	C	5: 38,262,074	S57P	probably damaging	Het
Tmem186	G	A	16: 8,636,023	R125W	probably benign	Het
Tnfaip3	A	G	10: 19,007,010	S220P	probably damaging	Het
Usp45	T	C	4: 21,830,505		probably null	Het
Vmn1r35	A	T	6: 66,679,589	C32*	probably null	Het
Vmn2r112	T	A	17: 22,601,322	F59I	probably benign	Het
Wfdc9	A	T	2: 164,650,538	S56R	probably benign	Het
Zfp369	A	G	13: 65,296,992	I650V	probably benign	Het

Other mutations in Usp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Usp5	APN	6	124829353	missense	probably benign	0.00
IGL00905:Usp5	APN	6	124815613	missense	probably damaging	1.00
IGL01584:Usp5	APN	6	124819387	missense	probably damaging	1.00
IGL01642:Usp5	APN	6	124820453	missense	probably damaging	0.99
IGL01787:Usp5	APN	6	124824226	missense	possibly damaging	0.95
IGL02394:Usp5	APN	6	124822709	missense	probably damaging	1.00
IGL02677:Usp5	APN	6	124819426	missense	probably damaging	1.00
IGL03392:Usp5	APN	6	124826387	missense	probably damaging	1.00
BB004:Usp5	UTSW	6	124824229	missense	probably benign	0.06
BB014:Usp5	UTSW	6	124824229	missense	probably benign	0.06
R0594:Usp5	UTSW	6	124817424	missense	probably damaging	0.99
R1522:Usp5	UTSW	6	124825166	missense	probably benign
R1719:Usp5	UTSW	6	124823460	missense	possibly damaging	0.94
R2185:Usp5	UTSW	6	124817410	missense	probably damaging	0.99
R3115:Usp5	UTSW	6	124815597	missense	probably damaging	1.00
R4196:Usp5	UTSW	6	124824938	missense	possibly damaging	0.78
R4347:Usp5	UTSW	6	124821195	missense	probably damaging	1.00
R4500:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4501:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4526:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4527:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4528:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4684:Usp5	UTSW	6	124817956	missense	probably damaging	1.00
R4912:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4913:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4954:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4956:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4957:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R4958:Usp5	UTSW	6	124822630	missense	possibly damaging	0.71
R5071:Usp5	UTSW	6	124826379	missense	probably benign	0.13
R6020:Usp5	UTSW	6	124817613	unclassified	probably benign
R6236:Usp5	UTSW	6	124818478	missense	probably benign	0.05
R6370:Usp5	UTSW	6	124820428	missense	probably benign	0.01
R7090:Usp5	UTSW	6	124829394	start codon destroyed	probably null
R7317:Usp5	UTSW	6	124826318	missense	probably damaging	0.98
R7447:Usp5	UTSW	6	124821114	missense	probably damaging	1.00
R7572:Usp5	UTSW	6	124818007	missense	probably damaging	0.99
R7598:Usp5	UTSW	6	124826379	missense	possibly damaging	0.73
R7927:Usp5	UTSW	6	124824229	missense	probably benign	0.06
R7931:Usp5	UTSW	6	124824446	intron	probably benign
R8089:Usp5	UTSW	6	124820410	critical splice donor site	probably null
R8361:Usp5	UTSW	6	124824985	missense	probably damaging	1.00
R8544:Usp5	UTSW	6	124823517	missense	probably damaging	1.00
R8679:Usp5	UTSW	6	124817431	missense	possibly damaging	0.94
R9115:Usp5	UTSW	6	124826421	missense	probably damaging	0.97
R9128:Usp5	UTSW	6	124823451	critical splice donor site	probably null
R9227:Usp5	UTSW	6	124818636	missense	probably damaging	1.00
R9651:Usp5	UTSW	6	124822538	missense	possibly damaging	0.91
X0058:Usp5	UTSW	6	124824176	missense	probably damaging	1.00
Z1177:Usp5	UTSW	6	124825148	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AATGCAGCTGGGACTACCTC -3'
(R):5'- TGCAGGTTAGCATCAGGGAG -3'

Sequencing Primer
(F):5'- TGGGACTACCTCAGCCAGTCTC -3'
(R):5'- ACCGTTCCGATTGCAGATG -3'

Posted On

2016-03-21