Incidental Mutation 'R4956:Usp5'
ID381574
Institutional Source Beutler Lab
Gene Symbol Usp5
Ensembl Gene ENSMUSG00000038429
Gene Nameubiquitin specific peptidase 5 (isopeptidase T)
SynonymsUcht
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124815019-124829484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 124822630 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 318 (K318N)
Ref Sequence ENSEMBL: ENSMUSP00000041299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000142058] [ENSMUST00000153306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047510
AA Change: K318N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 656 694 3.12e-7 SMART
UBA 724 761 8.63e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122110
AA Change: K318N

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 633 671 3.12e-7 SMART
UBA 701 738 8.63e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141042
Predicted Effect possibly damaging
Transcript: ENSMUST00000142058
AA Change: K300N

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429
AA Change: K300N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-20 BLAST
ZnF_UBP 180 235 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146098
Predicted Effect probably benign
Transcript: ENSMUST00000153306
SMART Domains Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
Blast:ZnF_UBP 1 32 3e-7 BLAST
ZnF_UBP 152 207 6.47e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154189
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (see MIM 191339)-dependent proteolysis is a complex pathway of protein metabolism implicated in such diverse cellular functions as maintenance of chromatin structure, receptor function, and degradation of abnormal proteins. A late step of the process involves disassembly of the polyubiquitin chains on degraded proteins into ubiquitin monomers. USP5 disassembles branched polyubiquitin chains by a sequential exo mechanism, starting at the proximal end of the chain (Wilkinson et al., 1995 [PubMed 7578059]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Plod3 A G 5: 136,989,918 N270D probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Usp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp5 APN 6 124829353 missense probably benign 0.00
IGL00905:Usp5 APN 6 124815613 missense probably damaging 1.00
IGL01584:Usp5 APN 6 124819387 missense probably damaging 1.00
IGL01642:Usp5 APN 6 124820453 missense probably damaging 0.99
IGL01787:Usp5 APN 6 124824226 missense possibly damaging 0.95
IGL02394:Usp5 APN 6 124822709 missense probably damaging 1.00
IGL02677:Usp5 APN 6 124819426 missense probably damaging 1.00
IGL03392:Usp5 APN 6 124826387 missense probably damaging 1.00
R0594:Usp5 UTSW 6 124817424 missense probably damaging 0.99
R1522:Usp5 UTSW 6 124825166 missense probably benign
R1719:Usp5 UTSW 6 124823460 missense possibly damaging 0.94
R2185:Usp5 UTSW 6 124817410 missense probably damaging 0.99
R3115:Usp5 UTSW 6 124815597 missense probably damaging 1.00
R4196:Usp5 UTSW 6 124824938 missense possibly damaging 0.78
R4347:Usp5 UTSW 6 124821195 missense probably damaging 1.00
R4386:Usp5 UTSW 6 124818474 critical splice donor site probably null
R4500:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4501:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4526:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4527:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4528:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4684:Usp5 UTSW 6 124817956 missense probably damaging 1.00
R4912:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4913:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4954:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4957:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R4958:Usp5 UTSW 6 124822630 missense possibly damaging 0.71
R5071:Usp5 UTSW 6 124826379 missense probably benign 0.13
R6020:Usp5 UTSW 6 124817613 unclassified probably benign
R6236:Usp5 UTSW 6 124818478 missense probably benign 0.05
R6370:Usp5 UTSW 6 124820428 missense probably benign 0.01
R7090:Usp5 UTSW 6 124829394 start codon destroyed probably null
R7317:Usp5 UTSW 6 124826318 missense probably damaging 0.98
R7447:Usp5 UTSW 6 124821114 missense probably damaging 1.00
R7572:Usp5 UTSW 6 124818007 missense probably damaging 0.99
R7598:Usp5 UTSW 6 124826379 missense possibly damaging 0.73
R8089:Usp5 UTSW 6 124820410 critical splice donor site probably null
X0058:Usp5 UTSW 6 124824176 missense probably damaging 1.00
Z1177:Usp5 UTSW 6 124825148 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCCCTCCTTAAGTAATGC -3'
(R):5'- CGAGGATGAGTCTTAGTCCAG -3'

Sequencing Primer
(F):5'- GGCCCTCCTTAAGTAATGCTAAAATG -3'
(R):5'- TCTTAGTCCAGAGCTTAGAGACG -3'
Posted On2016-04-27