Incidental Mutation 'R4909:Ap2a1'
ID379288
Institutional Source Beutler Lab
Gene Symbol Ap2a1
Ensembl Gene ENSMUSG00000060279
Gene Nameadaptor-related protein complex 2, alpha 1 subunit
SynonymsAdtaa
MMRRC Submission 042511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R4909 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44900373-44929496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44906381 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 355 (T355M)
Ref Sequence ENSEMBL: ENSMUSP00000127497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930]
Predicted Effect probably damaging
Transcript: ENSMUST00000085399
AA Change: T355M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279
AA Change: T355M

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107857
AA Change: T355M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279
AA Change: T355M

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166972
AA Change: T355M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279
AA Change: T355M

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167930
AA Change: T355M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279
AA Change: T355M

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207426
Predicted Effect probably benign
Transcript: ENSMUST00000207814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208291
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209067
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik A T 12: 20,815,088 noncoding transcript Het
A830010M20Rik C T 5: 107,507,310 Q992* probably null Het
Aars G A 8: 111,055,083 G929D probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Actn4 A T 7: 28,898,657 L506Q probably damaging Het
Adam26a A T 8: 43,570,438 F5Y probably benign Het
Adamts5 G A 16: 85,900,066 Q68* probably null Het
Adcy9 A G 16: 4,298,754 I871T probably benign Het
Ak5 A T 3: 152,655,877 L136H probably damaging Het
Ap1g2 A G 14: 55,105,026 probably null Het
Ap3s2 T C 7: 79,915,241 D60G possibly damaging Het
Apold1 G A 6: 134,983,595 R4Q probably benign Het
Atp13a5 G T 16: 29,334,028 Q207K possibly damaging Het
BC035947 A C 1: 78,498,029 I622S probably damaging Het
Bmper G T 9: 23,377,725 V339F probably benign Het
C1ra A G 6: 124,522,334 D493G probably damaging Het
C3 C T 17: 57,226,830 probably null Het
Cabp4 T A 19: 4,137,121 I209F possibly damaging Het
Cacna1s A T 1: 136,079,604 H453L probably damaging Het
Camk2g A G 14: 20,792,584 V32A probably benign Het
Ccdc175 G A 12: 72,159,753 R240C probably damaging Het
Cdk13 C T 13: 17,772,403 S590N possibly damaging Het
Cfap45 A T 1: 172,529,876 T24S probably benign Het
Clca1 T G 3: 145,024,563 K174Q probably damaging Het
Col1a2 G A 6: 4,529,058 probably benign Het
Colgalt1 A T 8: 71,620,633 I323F possibly damaging Het
Cpeb3 T C 19: 37,174,233 S248G possibly damaging Het
Cpeb3 A T 19: 37,174,659 S106T probably damaging Het
Ctcfl C T 2: 173,095,398 A576T probably benign Het
Cyp4f16 T G 17: 32,550,321 V395G possibly damaging Het
Dchs1 C T 7: 105,766,255 G605S probably damaging Het
Egflam A T 15: 7,219,629 F903I probably damaging Het
Eif5a G A 11: 69,917,485 A62V possibly damaging Het
Fam217a A G 13: 34,910,406 S609P probably damaging Het
Fhad1 T A 4: 141,985,511 I206F probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fras1 T A 5: 96,708,758 M2000K probably benign Het
Frmd5 C T 2: 121,591,653 probably null Het
Gle1 T C 2: 29,936,080 L57P probably benign Het
Glrx3 C A 7: 137,445,036 N52K probably damaging Het
Grin3b A G 10: 79,977,104 *1004W probably null Het
Hectd4 T A 5: 121,263,891 F347L probably benign Het
Htra1 G A 7: 130,985,072 V462I probably benign Het
Itga11 A G 9: 62,755,299 Y518C probably damaging Het
Krtap15 T C 16: 88,829,365 F88L probably benign Het
Ktn1 A T 14: 47,706,460 R866W probably damaging Het
Lamb1 G A 12: 31,288,281 R483H probably damaging Het
Megf6 C T 4: 154,265,391 R983C probably damaging Het
Mybpc3 T A 2: 91,134,812 D1075E probably benign Het
Myo7b A T 18: 31,964,436 N1792K probably benign Het
Nabp2 A T 10: 128,401,687 probably benign Het
Neil3 A G 8: 53,638,893 C7R probably damaging Het
Nxpe2 T A 9: 48,319,597 I491F possibly damaging Het
Obscn A G 11: 59,061,465 V4292A possibly damaging Het
Ogfod3 A G 11: 121,197,492 S139P probably damaging Het
Olfr374 A G 8: 72,109,581 N5S probably damaging Het
Olfr418 A T 1: 173,270,979 D268V probably damaging Het
Olfr682-ps1 C A 7: 105,128,228 V70L probably benign Het
Olfr800 A G 10: 129,660,720 I305V probably benign Het
Oog2 T C 4: 144,195,099 I211T possibly damaging Het
Oosp1 T C 19: 11,688,716 D70G probably benign Het
Padi3 T C 4: 140,795,626 D345G probably damaging Het
Pcyt2 A G 11: 120,615,420 F71L probably benign Het
Pi4k2b T C 5: 52,754,629 probably benign Het
Pigr A C 1: 130,848,458 T577P possibly damaging Het
Pirb G A 7: 3,719,362 Q161* probably null Het
Pnlip A G 19: 58,676,240 E204G possibly damaging Het
Pop7 G T 5: 137,501,899 D57E probably benign Het
Ppfia4 A T 1: 134,332,501 I8N probably damaging Het
Pprc1 A G 19: 46,064,319 T759A probably damaging Het
Prom1 T C 5: 44,045,552 N213S probably benign Het
Prop1 GCTTCACT GCTTCACTTCACT 11: 50,952,036 probably null Het
Prop1 A T 11: 50,952,045 L105H probably damaging Het
Pwp2 A T 10: 78,182,494 M121K possibly damaging Het
Rap1gds1 A T 3: 138,983,748 M161K possibly damaging Het
Rps6kb2 T A 19: 4,157,003 probably benign Het
Rxfp1 A G 3: 79,644,802 S731P probably benign Het
Scfd1 T C 12: 51,390,412 V137A probably benign Het
Slc6a15 G A 10: 103,404,414 D333N probably damaging Het
Sqor T C 2: 122,785,181 V74A possibly damaging Het
Stil T A 4: 115,024,225 Y655* probably null Het
Syt14 A T 1: 192,898,859 I468K probably damaging Het
Tbc1d31 T C 15: 57,962,265 probably null Het
Tspyl5 A T 15: 33,686,849 S317T probably damaging Het
Ttf1 C T 2: 29,064,656 H11Y possibly damaging Het
Ttf2 T C 3: 100,954,315 T620A probably damaging Het
Usp32 G A 11: 85,055,772 Q269* probably null Het
Vsig10 T A 5: 117,338,243 V254E probably benign Het
Wdr6 C T 9: 108,572,988 A1114T probably benign Het
Zfp280d A G 9: 72,331,432 S63G probably damaging Het
Zfp607b A G 7: 27,703,796 D559G probably benign Het
Zfp934 T C 13: 62,517,954 H291R probably damaging Het
Other mutations in Ap2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ap2a1 APN 7 44905768 missense probably damaging 1.00
IGL01315:Ap2a1 APN 7 44916289 missense possibly damaging 0.47
IGL01324:Ap2a1 APN 7 44905696 missense probably damaging 1.00
IGL02545:Ap2a1 APN 7 44906426 missense probably damaging 1.00
IGL03067:Ap2a1 APN 7 44903511 missense probably benign
IGL03172:Ap2a1 APN 7 44904055 missense probably benign 0.00
disaffected UTSW 7 44916164 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0546:Ap2a1 UTSW 7 44904708 missense probably damaging 0.97
R1103:Ap2a1 UTSW 7 44904169 unclassified probably benign
R1566:Ap2a1 UTSW 7 44903480 missense probably benign 0.02
R1682:Ap2a1 UTSW 7 44915938 missense probably benign 0.14
R1745:Ap2a1 UTSW 7 44906945 missense probably damaging 1.00
R1777:Ap2a1 UTSW 7 44904152 missense probably damaging 1.00
R4627:Ap2a1 UTSW 7 44904419 missense probably damaging 1.00
R4669:Ap2a1 UTSW 7 44902919 unclassified probably benign
R4776:Ap2a1 UTSW 7 44901546 unclassified probably benign
R5040:Ap2a1 UTSW 7 44905804 missense possibly damaging 0.78
R5278:Ap2a1 UTSW 7 44902779 missense probably benign 0.00
R5310:Ap2a1 UTSW 7 44906065 splice site probably null
R5517:Ap2a1 UTSW 7 44906981 missense possibly damaging 0.93
R5635:Ap2a1 UTSW 7 44923901 intron probably benign
R6002:Ap2a1 UTSW 7 44904395 splice site probably null
R6083:Ap2a1 UTSW 7 44907751 missense probably damaging 1.00
R6185:Ap2a1 UTSW 7 44916170 missense probably damaging 1.00
R6430:Ap2a1 UTSW 7 44903829 missense probably benign
R6491:Ap2a1 UTSW 7 44916164 missense probably damaging 1.00
R7058:Ap2a1 UTSW 7 44900791 missense probably damaging 1.00
R7180:Ap2a1 UTSW 7 44923804 splice site probably null
R7490:Ap2a1 UTSW 7 44902789 missense probably benign 0.03
R7765:Ap2a1 UTSW 7 44909736 missense probably damaging 1.00
R7831:Ap2a1 UTSW 7 44901012 missense probably damaging 1.00
R8237:Ap2a1 UTSW 7 44900796 missense probably damaging 1.00
R8334:Ap2a1 UTSW 7 44904711 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGGCATACAGGAGATCAGCC -3'
(R):5'- AGTGCTTCCCTCTATCTGGG -3'

Sequencing Primer
(F):5'- CCGCTCCGTCTGAGGAAAG -3'
(R):5'- TTCCTAGGAGGGACCCAGTAG -3'
Posted On2016-04-15