Mutagenetix > Incidental Mutation

Incidental Mutation 'R4927:Ttf1'

380886

Institutional Source

Beutler Lab

Gene Symbol

Ttf1

Ensembl Gene

ENSMUSG00000026803

Gene Name

transcription termination factor, RNA polymerase I

Synonyms

MMRRC Submission

042528-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R4927 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29060262-29087656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 29064656 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 11 (H11Y)

Ref Sequence

ENSEMBL: ENSMUSP00000097809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100237]

AlphaFold

Q62187

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100237
AA Change: H11Y

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000097809
Gene: ENSMUSG00000026803
AA Change: H11Y

Domain	Start	End	E-Value	Type
internal_repeat_1	13	67	1.04e-14	PROSPERO
internal_repeat_1	85	142	1.04e-14	PROSPERO
low complexity region	143	153	N/A	INTRINSIC
low complexity region	171	183	N/A	INTRINSIC
low complexity region	274	293	N/A	INTRINSIC
low complexity region	350	387	N/A	INTRINSIC
low complexity region	434	447	N/A	INTRINSIC
low complexity region	451	461	N/A	INTRINSIC
Blast:SANT	508	585	8e-28	BLAST
SANT	589	636	2.37e-6	SMART
SANT	638	720	1.8e-6	SMART
low complexity region	805	819	N/A	INTRINSIC
low complexity region	842	857	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142786

Meta Mutation Damage Score

0.1959

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

97% (76/78)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	C	T	18: 57,730,816	Q213*	probably null	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Adamts2	T	A	11: 50,803,812	L1142*	probably null	Het
Arl13b	C	A	16: 62,801,787	G381V	probably damaging	Het
Ash1l	G	T	3: 88,985,334	V1507F	probably damaging	Het
Babam2	T	A	5: 31,702,064	F38I	probably benign	Het
Bend4	T	C	5: 67,400,276	Y399C	probably damaging	Het
Btn1a1	A	T	13: 23,460,624		probably null	Het
Cacna1g	A	T	11: 94,429,147	L1401Q	probably damaging	Het
Cep192	T	C	18: 67,835,124	V893A	probably benign	Het
Cnot10	A	T	9: 114,617,944	Y355N	probably damaging	Het
Col6a5	G	C	9: 105,933,964	S785R	unknown	Het
Cpa3	A	G	3: 20,222,139	L310P	probably damaging	Het
Cux2	A	G	5: 121,877,089	I247T	probably benign	Het
Dab1	A	G	4: 104,704,252	T245A	probably benign	Het
Dmrta1	A	T	4: 89,691,748	D315V	probably damaging	Het
Dnah12	T	A	14: 26,861,805	L599*	probably null	Het
Dync1h1	T	C	12: 110,662,855	I4231T	possibly damaging	Het
Fat1	T	C	8: 45,022,963	V1659A	probably damaging	Het
Flot2	G	A	11: 78,059,062	V406M	probably damaging	Het
Galnt2	A	G	8: 124,305,623	D75G	probably damaging	Het
Gcnt3	A	T	9: 70,035,182	C35S	probably damaging	Het
Gm13103	A	T	4: 143,851,617	Q149L	probably damaging	Het
Gp2	A	G	7: 119,452,895	F199L	probably benign	Het
Gramd3	C	T	18: 56,485,451	P244S	probably damaging	Het
Hhipl1	T	C	12: 108,311,944	L177P	probably damaging	Het
Homez	T	C	14: 54,857,807	E148G	possibly damaging	Het
Kcnab3	G	A	11: 69,326,746	C22Y	possibly damaging	Het
Kcnh8	C	A	17: 52,877,981	S430R	probably damaging	Het
Kcnn2	T	C	18: 45,559,731	C125R	probably benign	Het
Klhl7	G	A	5: 24,141,187	R277Q	possibly damaging	Het
Krt78	A	G	15: 101,946,899	S826P	probably benign	Het
Krtap14	T	C	16: 88,826,031	Y20C	possibly damaging	Het
Lrcol1	A	G	5: 110,354,297		probably null	Het
Lrrc10b	G	A	19: 10,456,862	P152S	probably damaging	Het
Lrrn3	C	G	12: 41,453,125	D398H	probably damaging	Het
Map3k19	T	C	1: 127,822,195	I1140V	probably benign	Het
Mos	G	A	4: 3,871,093	T241M	probably damaging	Het
Nol8	A	G	13: 49,654,425	E39G	possibly damaging	Het
Olfm1	T	G	2: 28,214,786	S212A	probably benign	Het
Olfr319	T	A	11: 58,701,807	F35L	probably damaging	Het
Papd7	A	T	13: 69,502,900		probably null	Het
Plec	G	T	15: 76,176,962	T2947K	probably damaging	Het
Rasgrp3	A	G	17: 75,516,355	M474V	probably benign	Het
Ryr1	T	C	7: 29,019,983	Y4333C	unknown	Het
Scrn2	G	C	11: 97,033,500		probably null	Het
Slc22a12	C	A	19: 6,537,761	V388L	probably benign	Het
Slc4a11	A	G	2: 130,684,946	V754A	probably damaging	Het
Slco2b1	A	G	7: 99,685,988	F195S	probably damaging	Het
Slfn9	A	C	11: 82,981,390	M840R	possibly damaging	Het
Speer4b	T	C	5: 27,501,265	N35D	probably damaging	Het
Taf1d	T	A	9: 15,309,954	D185E	probably damaging	Het
Taok2	A	G	7: 126,876,041	L245P	probably damaging	Het
Ticam2	T	C	18: 46,560,779	I80M	probably damaging	Het
Tmem268	G	A	4: 63,583,927	V331I	probably benign	Het
Tmem55a	G	T	4: 14,912,458	R189L	probably damaging	Het
Tsga10	T	C	1: 37,801,850	E425G	probably damaging	Het
Ttc7	A	G	17: 87,346,705		probably null	Het
Unc13a	T	C	8: 71,654,845	H601R	probably damaging	Het
Vmn2r102	A	T	17: 19,660,399	M1L	probably benign	Het
Vmn2r120	G	T	17: 57,509,125	N743K	probably damaging	Het
Wnt6	C	A	1: 74,784,136		probably null	Het
Wnt6	A	C	1: 74,784,137		probably null	Het
Wnt8a	T	A	18: 34,547,472	C297S	probably damaging	Het
Zfp786	T	C	6: 47,820,153	Q617R	probably benign	Het
Zfp91	A	G	19: 12,776,410		probably null	Het
Zw10	T	A	9: 49,068,683	F371L	probably damaging	Het

Other mutations in Ttf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Ttf1	APN	2	29073883	splice site	probably benign
IGL00916:Ttf1	APN	2	29070042	missense	probably benign	0.05
IGL02148:Ttf1	APN	2	29079426	missense	probably benign	0.17
IGL02631:Ttf1	APN	2	29069900	missense	probably damaging	0.98
IGL02658:Ttf1	APN	2	29074011	missense	probably damaging	1.00
IGL03057:Ttf1	APN	2	29071345	missense	probably damaging	0.98
R0026:Ttf1	UTSW	2	29071349	missense	possibly damaging	0.95
R0047:Ttf1	UTSW	2	29084655	missense	probably damaging	1.00
R0047:Ttf1	UTSW	2	29084655	missense	probably damaging	1.00
R0427:Ttf1	UTSW	2	29065042	missense	probably benign	0.00
R0466:Ttf1	UTSW	2	29065407	missense	possibly damaging	0.79
R0834:Ttf1	UTSW	2	29073950	nonsense	probably null
R1548:Ttf1	UTSW	2	29065138	missense	probably damaging	0.96
R1672:Ttf1	UTSW	2	29067152	missense	probably damaging	0.98
R1696:Ttf1	UTSW	2	29070002	missense	probably damaging	1.00
R1819:Ttf1	UTSW	2	29074784	missense	possibly damaging	0.60
R2000:Ttf1	UTSW	2	29065185	missense	possibly damaging	0.79
R2126:Ttf1	UTSW	2	29071345	missense	probably damaging	0.98
R2426:Ttf1	UTSW	2	29067185	missense	probably damaging	0.98
R2967:Ttf1	UTSW	2	29065383	missense	possibly damaging	0.56
R3499:Ttf1	UTSW	2	29065487	missense	possibly damaging	0.92
R3963:Ttf1	UTSW	2	29064804	missense	possibly damaging	0.68
R4342:Ttf1	UTSW	2	29065476	missense	probably benign	0.01
R4627:Ttf1	UTSW	2	29065160	missense	possibly damaging	0.72
R4676:Ttf1	UTSW	2	29074594	missense	probably damaging	0.96
R4907:Ttf1	UTSW	2	29064656	missense	possibly damaging	0.72
R4909:Ttf1	UTSW	2	29064656	missense	possibly damaging	0.72
R4926:Ttf1	UTSW	2	29064656	missense	possibly damaging	0.72
R5746:Ttf1	UTSW	2	29065742	missense	probably damaging	0.96
R5948:Ttf1	UTSW	2	29073920	missense	possibly damaging	0.50
R6911:Ttf1	UTSW	2	29064851	missense	probably benign	0.41
R7909:Ttf1	UTSW	2	29065459	missense	probably benign	0.00
R8141:Ttf1	UTSW	2	29067226	nonsense	probably null
R8264:Ttf1	UTSW	2	29064677	missense	possibly damaging	0.91
R8863:Ttf1	UTSW	2	29079480	critical splice donor site	probably null
R9094:Ttf1	UTSW	2	29067068	missense	probably benign	0.15
R9281:Ttf1	UTSW	2	29065890	missense	probably benign	0.01
R9318:Ttf1	UTSW	2	29074654	missense	possibly damaging	0.47
R9440:Ttf1	UTSW	2	29065697	missense	probably benign	0.41
R9483:Ttf1	UTSW	2	29079480	critical splice donor site	probably null
X0066:Ttf1	UTSW	2	29074775	missense	probably benign	0.05
Z1176:Ttf1	UTSW	2	29065812	missense	probably damaging	1.00
Z1176:Ttf1	UTSW	2	29071337	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTGTCGCACGCACCTATG -3'
(R):5'- AGGCCACTCACTCTCTAAGG -3'

Sequencing Primer
(F):5'- TCTAGGCAAAGTGGATCTCAC -3'
(R):5'- CTCTAAGGTCTCCTGGGCTG -3'

Posted On

2016-04-15