Incidental Mutation 'R5070:Rgs8'
ID388607
Institutional Source Beutler Lab
Gene Symbol Rgs8
Ensembl Gene ENSMUSG00000042671
Gene Nameregulator of G-protein signaling 8
Synonyms6530413N01Rik
MMRRC Submission 042660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5070 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153653025-153700323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153665904 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 3 (T3I)
Ref Sequence ENSEMBL: ENSMUSP00000107446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041776] [ENSMUST00000111810] [ENSMUST00000111812] [ENSMUST00000111814] [ENSMUST00000111815] [ENSMUST00000124500] [ENSMUST00000147482] [ENSMUST00000147700] [ENSMUST00000152114]
Predicted Effect probably benign
Transcript: ENSMUST00000041776
SMART Domains Protein: ENSMUSP00000045715
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111810
SMART Domains Protein: ENSMUSP00000107441
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111812
SMART Domains Protein: ENSMUSP00000107443
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111814
AA Change: T3I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107445
Gene: ENSMUSG00000042671
AA Change: T3I

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111815
AA Change: T3I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107446
Gene: ENSMUSG00000042671
AA Change: T3I

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124500
SMART Domains Protein: ENSMUSP00000122518
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
Pfam:RGS 56 99 2.3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147482
AA Change: T3I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118365
Gene: ENSMUSG00000042671
AA Change: T3I

DomainStartEndE-ValueType
Pfam:RGS 54 115 6.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147700
SMART Domains Protein: ENSMUSP00000123565
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
Pfam:RGS 56 115 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147794
Predicted Effect probably benign
Transcript: ENSMUST00000152114
SMART Domains Protein: ENSMUSP00000121910
Gene: ENSMUSG00000042671

DomainStartEndE-ValueType
RGS 56 137 1.52e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and Purkinje cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik G T 15: 84,420,163 A14E possibly damaging Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
Acacb T C 5: 114,246,028 I2206T possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
AI987944 C T 7: 41,375,324 G77D probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
Bend3 A T 10: 43,493,685 E11D probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Cds2 T A 2: 132,302,088 Y4* probably null Het
Celsr1 G T 15: 85,939,134 P1691Q possibly damaging Het
Chmp1a A T 8: 123,206,315 V133E probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Comp G A 8: 70,376,495 G272S probably benign Het
Csnk1a1 T A 18: 61,555,781 F11I probably benign Het
Ctse A G 1: 131,668,179 D203G probably damaging Het
Cyp1b1 T A 17: 79,710,611 M372L probably benign Het
Cyp2c66 T A 19: 39,163,470 S210T probably benign Het
Dnah1 G A 14: 31,282,418 P2385S probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Eif4g3 A G 4: 138,146,299 T682A probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fam136b-ps C T 15: 31,276,716 probably benign Het
Fbxl7 T A 15: 26,789,554 H29L probably benign Het
Fbxw22 A G 9: 109,385,115 V211A probably benign Het
Frk A T 10: 34,484,284 K94* probably null Het
G0s2 T A 1: 193,272,562 E71D probably damaging Het
Gfpt1 A G 6: 87,053,745 probably null Het
Gga1 A G 15: 78,892,017 D420G possibly damaging Het
Gldc T C 19: 30,118,598 Q671R possibly damaging Het
Gpc6 A G 14: 117,186,769 T90A probably benign Het
Gucy2g C A 19: 55,229,787 V410F probably damaging Het
Ifnlr1 T C 4: 135,704,198 S233P probably benign Het
Ighv1-9 A T 12: 114,583,757 W55R probably damaging Het
Igsf10 T A 3: 59,328,293 H1489L probably benign Het
Il17re T C 6: 113,459,010 L39P probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Kcnk3 A G 5: 30,622,386 H260R possibly damaging Het
Kctd19 T C 8: 105,391,999 Y287C probably damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Lama2 A G 10: 27,350,251 probably null Het
Lrrc27 A T 7: 139,214,799 D26V probably damaging Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Mei1 T A 15: 82,077,603 C188S possibly damaging Het
Mettl13 C T 1: 162,545,899 R261H possibly damaging Het
Mex3a A T 3: 88,536,387 I257F probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mier2 T C 10: 79,549,577 D139G probably benign Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrvi1 A G 7: 110,925,312 S208P probably benign Het
Myh14 A G 7: 44,616,248 V1569A possibly damaging Het
Myo18b T C 5: 112,761,346 E1977G probably damaging Het
Myo3b T C 2: 70,253,112 L675P probably damaging Het
N4bp1 A G 8: 86,860,537 V591A probably damaging Het
Nedd9 C A 13: 41,316,598 V360L probably benign Het
Oit3 C T 10: 59,424,027 R518H probably damaging Het
Olfr1122 T G 2: 87,388,163 C153G probably damaging Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr171 A G 16: 19,624,992 I36T possibly damaging Het
Olfr342 T A 2: 36,527,766 M118K probably damaging Het
Olfr531 A G 7: 140,400,569 V159A probably benign Het
Olfr744 A G 14: 50,618,474 N84S probably benign Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pask A T 1: 93,330,874 C251S probably damaging Het
Pdzk1 A T 3: 96,850,321 D31V probably benign Het
Pmfbp1 A T 8: 109,530,155 Q497L probably damaging Het
Pofut1 T C 2: 153,261,566 probably benign Het
Polr2h A G 16: 20,721,966 N95S probably damaging Het
Pou2f3 A G 9: 43,145,281 V93A possibly damaging Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Prkd1 A T 12: 50,394,622 L327* probably null Het
Prrt4 T C 6: 29,177,512 E86G probably benign Het
Psen2 T C 1: 180,228,857 I393V probably benign Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Qser1 C T 2: 104,787,282 V1062I possibly damaging Het
Rab11b G T 17: 33,748,881 A114D probably damaging Het
Rag1 A T 2: 101,642,311 W829R probably damaging Het
Rgl3 A G 9: 21,988,044 probably null Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rps6kb2 A T 19: 4,163,228 D6E probably damaging Het
Skint5 T A 4: 113,795,538 I630F unknown Het
Skint7 T C 4: 111,984,134 L257P probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Sorl1 T C 9: 42,031,818 K921E possibly damaging Het
Stub1 A G 17: 25,832,138 L90P probably damaging Het
Sycp1 A T 3: 102,920,565 S289T probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tead3 T C 17: 28,341,477 K51R probably benign Het
Tmed11 T A 5: 108,795,223 I30L probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tmem191c A G 16: 17,277,695 Q206R probably null Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uqcrq A G 11: 53,430,127 probably null Het
Vmn1r215 T A 13: 23,076,496 S235R probably benign Het
Vmn1r70 T C 7: 10,634,398 V271A probably benign Het
Vps13a G A 19: 16,654,484 R2596C probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdr90 T C 17: 25,846,333 T1650A probably damaging Het
Zbtb32 T A 7: 30,591,466 M135L probably benign Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp30 A G 7: 29,786,266 probably benign Het
Zfp428 T A 7: 24,515,125 D55E probably damaging Het
Zfyve26 A T 12: 79,255,361 N1820K probably damaging Het
Zw10 C A 9: 49,077,459 S675* probably null Het
Other mutations in Rgs8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Rgs8 APN 1 153692723 critical splice acceptor site probably null
IGL02163:Rgs8 APN 1 153671765 missense possibly damaging 0.71
IGL02826:Rgs8 APN 1 153670799 missense probably damaging 1.00
IGL03345:Rgs8 APN 1 153692810 missense probably benign 0.34
R0561:Rgs8 UTSW 1 153665922 splice site probably null
R0801:Rgs8 UTSW 1 153670811 missense probably damaging 1.00
R3618:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4058:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4059:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4877:Rgs8 UTSW 1 153692887 unclassified probably benign
R5841:Rgs8 UTSW 1 153692828 missense probably damaging 1.00
R6028:Rgs8 UTSW 1 153690988 missense probably damaging 1.00
R6413:Rgs8 UTSW 1 153692873 missense probably damaging 1.00
R7682:Rgs8 UTSW 1 153690922 missense probably damaging 1.00
X0028:Rgs8 UTSW 1 153670846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAAGAGCTTTTGGGGCC -3'
(R):5'- TCACAAGTGACTGGAGCAGAC -3'

Sequencing Primer
(F):5'- TTGCTGCCTGGCTCAAG -3'
(R):5'- GCTTTCCAACATCCCAGA -3'
Posted On2016-06-06