Mutagenetix > Incidental Mutation

Incidental Mutation 'R5070:Acacb'

388635

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

042660-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5070 (G1)

Quality Score

179

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114246028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2206 (I2206T)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: I2206T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: I2206T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: I2206T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: I2206T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	G	T	15: 84,420,163	A14E	possibly damaging	Het
3425401B19Rik	A	G	14: 32,661,792	S739P	possibly damaging	Het
Actn2	A	G	13: 12,288,522	I464T	possibly damaging	Het
AI987944	C	T	7: 41,375,324	G77D	probably benign	Het
Ankar	T	C	1: 72,680,210		probably null	Het
Armc9	A	T	1: 86,257,237	H670L	probably benign	Het
Arvcf	A	G	16: 18,398,986	Y412C	probably damaging	Het
Baiap3	A	T	17: 25,249,108	C283S	probably damaging	Het
Bend3	A	T	10: 43,493,685	E11D	probably damaging	Het
Birc6	C	T	17: 74,565,972	R409C	probably damaging	Het
Cds2	T	A	2: 132,302,088	Y4*	probably null	Het
Celsr1	G	T	15: 85,939,134	P1691Q	possibly damaging	Het
Chmp1a	A	T	8: 123,206,315	V133E	probably benign	Het
Cnbd2	T	C	2: 156,335,398	V92A	probably damaging	Het
Comp	G	A	8: 70,376,495	G272S	probably benign	Het
Csnk1a1	T	A	18: 61,555,781	F11I	probably benign	Het
Ctse	A	G	1: 131,668,179	D203G	probably damaging	Het
Cyp1b1	T	A	17: 79,710,611	M372L	probably benign	Het
Cyp2c66	T	A	19: 39,163,470	S210T	probably benign	Het
Dnah1	G	A	14: 31,282,418	P2385S	probably benign	Het
Dsp	A	C	13: 38,197,123	T2615P	possibly damaging	Het
Eif4g3	A	G	4: 138,146,299	T682A	probably benign	Het
Enpp2	T	C	15: 54,864,054	Y513C	probably damaging	Het
Ercc6	T	C	14: 32,570,063	V1128A	probably benign	Het
Fam136b-ps	C	T	15: 31,276,716		probably benign	Het
Fbxl7	T	A	15: 26,789,554	H29L	probably benign	Het
Fbxw22	A	G	9: 109,385,115	V211A	probably benign	Het
Frk	A	T	10: 34,484,284	K94*	probably null	Het
G0s2	T	A	1: 193,272,562	E71D	probably damaging	Het
Gfpt1	A	G	6: 87,053,745		probably null	Het
Gga1	A	G	15: 78,892,017	D420G	possibly damaging	Het
Gldc	T	C	19: 30,118,598	Q671R	possibly damaging	Het
Gpc6	A	G	14: 117,186,769	T90A	probably benign	Het
Gucy2g	C	A	19: 55,229,787	V410F	probably damaging	Het
Ifnlr1	T	C	4: 135,704,198	S233P	probably benign	Het
Ighv1-9	A	T	12: 114,583,757	W55R	probably damaging	Het
Igsf10	T	A	3: 59,328,293	H1489L	probably benign	Het
Il17re	T	C	6: 113,459,010	L39P	probably damaging	Het
Kcna2	T	A	3: 107,104,637	V178D	probably damaging	Het
Kcnk3	A	G	5: 30,622,386	H260R	possibly damaging	Het
Kctd19	T	C	8: 105,391,999	Y287C	probably damaging	Het
Klhl28	A	T	12: 64,957,712	M9K	probably benign	Het
Lama2	A	G	10: 27,350,251		probably null	Het
Lrrc27	A	T	7: 139,214,799	D26V	probably damaging	Het
Mcm4	A	G	16: 15,625,570	S830P	probably damaging	Het
Mei1	T	A	15: 82,077,603	C188S	possibly damaging	Het
Mettl13	C	T	1: 162,545,899	R261H	possibly damaging	Het
Mex3a	A	T	3: 88,536,387	I257F	probably damaging	Het
Mib1	A	G	18: 10,793,002	E646G	probably damaging	Het
Mier2	T	C	10: 79,549,577	D139G	probably benign	Het
Mmp14	T	A	14: 54,439,113	Y372N	probably damaging	Het
Mrvi1	A	G	7: 110,925,312	S208P	probably benign	Het
Myh14	A	G	7: 44,616,248	V1569A	possibly damaging	Het
Myo18b	T	C	5: 112,761,346	E1977G	probably damaging	Het
Myo3b	T	C	2: 70,253,112	L675P	probably damaging	Het
N4bp1	A	G	8: 86,860,537	V591A	probably damaging	Het
Nedd9	C	A	13: 41,316,598	V360L	probably benign	Het
Oit3	C	T	10: 59,424,027	R518H	probably damaging	Het
Olfr1122	T	G	2: 87,388,163	C153G	probably damaging	Het
Olfr1413	T	A	1: 92,573,413	S81T	probably damaging	Het
Olfr171	A	G	16: 19,624,992	I36T	possibly damaging	Het
Olfr342	T	A	2: 36,527,766	M118K	probably damaging	Het
Olfr531	A	G	7: 140,400,569	V159A	probably benign	Het
Olfr744	A	G	14: 50,618,474	N84S	probably benign	Het
Olfr744	T	A	14: 50,618,740	C173S	probably damaging	Het
Olfr749	C	A	14: 50,737,074	L29F	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pask	A	T	1: 93,330,874	C251S	probably damaging	Het
Pdzk1	A	T	3: 96,850,321	D31V	probably benign	Het
Pmfbp1	A	T	8: 109,530,155	Q497L	probably damaging	Het
Pofut1	T	C	2: 153,261,566		probably benign	Het
Polr2h	A	G	16: 20,721,966	N95S	probably damaging	Het
Pou2f3	A	G	9: 43,145,281	V93A	possibly damaging	Het
Ppfia1	G	A	7: 144,514,473	Q446*	probably null	Het
Prkd1	A	T	12: 50,394,622	L327*	probably null	Het
Prrt4	T	C	6: 29,177,512	E86G	probably benign	Het
Psen2	T	C	1: 180,228,857	I393V	probably benign	Het
Psma2	G	A	13: 14,616,028	V20I	probably benign	Het
Qser1	C	T	2: 104,787,282	V1062I	possibly damaging	Het
Rab11b	G	T	17: 33,748,881	A114D	probably damaging	Het
Rag1	A	T	2: 101,642,311	W829R	probably damaging	Het
Rgl3	A	G	9: 21,988,044		probably null	Het
Rgs8	C	T	1: 153,665,904	T3I	probably damaging	Het
Rnf17	T	C	14: 56,505,928	V1317A	probably damaging	Het
Rps6kb2	A	T	19: 4,163,228	D6E	probably damaging	Het
Skint5	T	A	4: 113,795,538	I630F	unknown	Het
Skint7	T	C	4: 111,984,134	L257P	probably damaging	Het
Slc11a1	G	A	1: 74,385,184	A434T	probably damaging	Het
Slc5a8	A	T	10: 88,886,598	I98F	possibly damaging	Het
Sorl1	T	C	9: 42,031,818	K921E	possibly damaging	Het
Stub1	A	G	17: 25,832,138	L90P	probably damaging	Het
Sycp1	A	T	3: 102,920,565	S289T	probably damaging	Het
Taar7b	T	G	10: 24,000,461	S175A	probably benign	Het
Tead3	T	C	17: 28,341,477	K51R	probably benign	Het
Tmed11	T	A	5: 108,795,223	I30L	probably benign	Het
Tmem131	A	G	1: 36,854,905	I139T	probably damaging	Het
Tmem191c	A	G	16: 17,277,695	Q206R	probably null	Het
Tph2	T	A	10: 115,151,174	Y237F	probably benign	Het
Trim35	C	T	14: 66,308,972		probably benign	Het
Tsc22d1	T	C	14: 76,418,310	I661T	probably benign	Het
Ttc27	T	A	17: 74,799,342	H541Q	probably damaging	Het
Uqcrq	A	G	11: 53,430,127		probably null	Het
Vmn1r215	T	A	13: 23,076,496	S235R	probably benign	Het
Vmn1r70	T	C	7: 10,634,398	V271A	probably benign	Het
Vps13a	G	A	19: 16,654,484	R2596C	probably benign	Het
Vwa7	G	A	17: 35,024,190	V615I	probably benign	Het
Wdr90	T	C	17: 25,846,333	T1650A	probably damaging	Het
Zbtb32	T	A	7: 30,591,466	M135L	probably benign	Het
Zc2hc1c	A	G	12: 85,290,514	D315G	probably benign	Het
Zfc3h1	T	A	10: 115,418,783	C1427*	probably null	Het
Zfp30	A	G	7: 29,786,266		probably benign	Het
Zfp428	T	A	7: 24,515,125	D55E	probably damaging	Het
Zfyve26	A	T	12: 79,255,361	N1820K	probably damaging	Het
Zw10	C	A	9: 49,077,459	S675*	probably null	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTAAGCAGGCCTCGCTTTGTAG -3'
(R):5'- CATGCCTGTAAAGATCATAGGTCAATG -3'

Sequencing Primer
(F):5'- CAGGCCTCGCTTTGTAGACATG -3'
(R):5'- CCACCTTACATTTTGAGGCAGGG -3'

Posted On

2016-06-06