Incidental Mutation 'R5191:Nr1h2'
ID398149
Institutional Source Beutler Lab
Gene Symbol Nr1h2
Ensembl Gene ENSMUSG00000060601
Gene Namenuclear receptor subfamily 1, group H, member 2
SynonymsRIP15, LXRB, Unr2, LXRbeta
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44549616-44553951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44550416 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 360 (A360S)
Ref Sequence ENSEMBL: ENSMUSP00000126788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000073488] [ENSMUST00000107910] [ENSMUST00000107911] [ENSMUST00000107912] [ENSMUST00000128600] [ENSMUST00000142298] [ENSMUST00000145956] [ENSMUST00000151793] [ENSMUST00000167197] [ENSMUST00000207737] [ENSMUST00000208366] [ENSMUST00000209017]
Predicted Effect probably benign
Transcript: ENSMUST00000049343
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073488
AA Change: A360S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073188
Gene: ENSMUSG00000060601
AA Change: A360S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107910
AA Change: A357S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103543
Gene: ENSMUSG00000060601
AA Change: A357S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107911
AA Change: A357S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103544
Gene: ENSMUSG00000060601
AA Change: A357S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107912
AA Change: A360S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103545
Gene: ENSMUSG00000060601
AA Change: A360S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128354
Predicted Effect probably benign
Transcript: ENSMUST00000128600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141901
Predicted Effect probably benign
Transcript: ENSMUST00000142298
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151793
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167197
AA Change: A360S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126788
Gene: ENSMUSG00000060601
AA Change: A360S

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207550
Predicted Effect probably benign
Transcript: ENSMUST00000207737
Predicted Effect unknown
Transcript: ENSMUST00000208322
AA Change: A278S
Predicted Effect probably benign
Transcript: ENSMUST00000208366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208368
Predicted Effect probably benign
Transcript: ENSMUST00000209017
Meta Mutation Damage Score 0.5873 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mutations cause altered lipid, cholesterol and glucose metabolism and may lead to elevated cartilage matrix catabolism and PGE2 production, lipid-laden uterus myocytes and Sertoli cells, impaired uterus contractility and parturition, and higher susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Galnt3 T C 2: 66,093,706 E406G probably damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Nr1h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Nr1h2 APN 7 44550460 missense probably damaging 1.00
IGL02327:Nr1h2 APN 7 44551500 unclassified probably benign
bisogno UTSW 7 44550013 missense probably damaging 1.00
quiero UTSW 7 44552537 missense probably benign 0.27
R0179:Nr1h2 UTSW 7 44552265 intron probably null
R0433:Nr1h2 UTSW 7 44549987 makesense probably null
R0597:Nr1h2 UTSW 7 44552260 intron probably benign
R2432:Nr1h2 UTSW 7 44551367 missense possibly damaging 0.46
R4635:Nr1h2 UTSW 7 44552537 missense probably benign 0.27
R4662:Nr1h2 UTSW 7 44550431 missense probably damaging 1.00
R4675:Nr1h2 UTSW 7 44552555 missense possibly damaging 0.66
R4782:Nr1h2 UTSW 7 44550499 missense possibly damaging 0.93
R5064:Nr1h2 UTSW 7 44551649 missense possibly damaging 0.82
R6266:Nr1h2 UTSW 7 44552052 nonsense probably null
R6933:Nr1h2 UTSW 7 44550013 missense probably damaging 1.00
R7323:Nr1h2 UTSW 7 44550322 missense possibly damaging 0.65
R7577:Nr1h2 UTSW 7 44550792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGACCCCAATACTGAG -3'
(R):5'- ATGTTTAGCGAGGCCAGATG -3'

Sequencing Primer
(F):5'- TGAGACTGCTCATATACAACAGG -3'
(R):5'- GAGTAACTGTCACAGGCTGTC -3'
Posted On2016-07-06