Incidental Mutation 'R5191:Galnt3'
ID398106
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Namepolypeptide N-acetylgalactosaminyltransferase 3
SynonymsppGaNTase-T3
MMRRC Submission 043263-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R5191 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66082766-66124994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66093706 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 406 (E406G)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
Predicted Effect probably damaging
Transcript: ENSMUST00000028378
AA Change: E406G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: E406G

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155453
Meta Mutation Damage Score 0.6607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,737,403 I638N possibly damaging Het
Acvrl1 A G 15: 101,137,065 E235G probably damaging Het
Adam26b T C 8: 43,519,991 D658G probably damaging Het
Adamts12 A G 15: 11,327,757 R1407G probably benign Het
Aknad1 T C 3: 108,751,990 S107P probably benign Het
Aknad1 G A 3: 108,752,551 V294I probably benign Het
Arfgef2 A G 2: 166,876,511 T1407A probably damaging Het
Atp5a1 C T 18: 77,780,229 P318S probably damaging Het
Atp9a C T 2: 168,662,063 V494M possibly damaging Het
Ccdc69 A T 11: 55,052,893 probably null Het
Crh T C 3: 19,693,929 E183G probably damaging Het
Cyp2c40 A C 19: 39,802,591 N265K probably damaging Het
D630003M21Rik C T 2: 158,201,035 A862T probably benign Het
Dact3 T G 7: 16,875,450 V9G probably damaging Het
Dnah8 A G 17: 30,746,765 E2357G probably damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Etl4 G T 2: 20,339,999 S38I probably damaging Het
Fyb2 G T 4: 104,995,797 C558F possibly damaging Het
Golga3 T A 5: 110,184,307 probably benign Het
Gpr179 T A 11: 97,338,149 Q1060L possibly damaging Het
Havcr1 A T 11: 46,756,197 I153F probably benign Het
Hnrnpc A T 14: 52,077,507 V141E probably damaging Het
Kcnj2 C T 11: 111,072,471 Q230* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Limch1 T C 5: 67,027,561 L631P probably damaging Het
Lpin1 T C 12: 16,580,828 N23S possibly damaging Het
Macf1 A G 4: 123,472,962 S1104P probably benign Het
Man2b1 A G 8: 85,084,459 D73G probably damaging Het
Marf1 A G 16: 14,146,078 F454L probably damaging Het
Mcpt4 T A 14: 56,061,009 I90L probably benign Het
Mfsd4b5 T C 10: 39,970,672 E304G probably damaging Het
Mst1r G A 9: 107,911,551 R423H probably damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Muc5b A G 7: 141,858,539 T1741A unknown Het
Myo1g C T 11: 6,515,105 A447T probably benign Het
Nr1h2 C A 7: 44,550,416 A360S probably damaging Het
Nufip1 A G 14: 76,111,989 K154E probably damaging Het
Olfr361 T G 2: 37,084,978 M257L probably benign Het
Olfr441 T A 6: 43,115,866 N41K probably damaging Het
Olfr857 G A 9: 19,713,334 C169Y probably damaging Het
Pecr A T 1: 72,274,977 probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Plec T C 15: 76,175,165 E3551G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sarm1 G A 11: 78,497,119 Q114* probably null Het
Sec31a T C 5: 100,405,511 E112G possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a2 G T 1: 40,743,893 R439L probably damaging Het
Sptb C A 12: 76,612,834 E1097D probably benign Het
Stk38 A C 17: 28,974,370 C362G probably benign Het
Stmn2 A T 3: 8,545,575 M40L probably benign Het
Sytl2 A T 7: 90,375,652 T283S probably damaging Het
Tcf4 A G 18: 69,642,883 S48G probably damaging Het
Tlr4 A T 4: 66,841,379 H803L probably damaging Het
Ttn C T 2: 76,879,088 probably benign Het
Tyk2 G T 9: 21,107,497 Q1099K probably damaging Het
Usp30 C T 5: 114,065,694 probably benign Het
Vmn1r175 A G 7: 23,809,022 V60A possibly damaging Het
Zc3h12d C A 10: 7,867,818 P451T possibly damaging Het
Zeb2 T C 2: 45,002,600 S146G probably benign Het
Zfp236 T A 18: 82,621,423 N1233I probably damaging Het
Zfp954 A G 7: 7,116,023 V174A probably damaging Het
Zswim1 G A 2: 164,826,019 S397N probably benign Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 66095284 missense probably damaging 1.00
IGL01563:Galnt3 APN 2 66097757 missense probably damaging 0.97
IGL01973:Galnt3 APN 2 66084262 missense probably benign 0.03
IGL02004:Galnt3 APN 2 66095926 missense probably damaging 1.00
IGL02424:Galnt3 APN 2 66095788 critical splice donor site probably null
IGL02946:Galnt3 APN 2 66095218 missense probably damaging 0.99
IGL03059:Galnt3 APN 2 66093610 missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 66107088 missense probably benign 0.03
R0437:Galnt3 UTSW 2 66107229 missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 66091223 missense probably damaging 1.00
R1536:Galnt3 UTSW 2 66084206 missense probably damaging 1.00
R1869:Galnt3 UTSW 2 66097779 missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 66084241 missense probably benign 0.00
R3973:Galnt3 UTSW 2 66107030 missense possibly damaging 0.77
R4039:Galnt3 UTSW 2 66085327 missense probably damaging 0.96
R4515:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4518:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4519:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4577:Galnt3 UTSW 2 66097859 missense probably benign 0.02
R4817:Galnt3 UTSW 2 66093539 missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 66085241 missense probably benign 0.04
R5947:Galnt3 UTSW 2 66084156 utr 3 prime probably benign
R6534:Galnt3 UTSW 2 66102531 missense probably damaging 1.00
R7196:Galnt3 UTSW 2 66090924 missense probably damaging 1.00
R7817:Galnt3 UTSW 2 66095899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGTAGCCCTCACTTACTTGC -3'
(R):5'- GTCTCTCGGTGCATTTAATGAAGC -3'

Sequencing Primer
(F):5'- GCTTAACGATTTTTGCTGCATCTG -3'
(R):5'- CTCGGTGCATTTAATGAAGCTATTG -3'
Posted On2016-07-06