Incidental Mutation 'R5245:Snrnp27'
ID401107
Institutional Source Beutler Lab
Gene Symbol Snrnp27
Ensembl Gene ENSMUSG00000001158
Gene Namesmall nuclear ribonucleoprotein 27 (U4/U6.U5)
Synonyms
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5245 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86675151-86684522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86682959 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000109313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001186] [ENSMUST00000113683]
Predicted Effect unknown
Transcript: ENSMUST00000001186
AA Change: S18P
SMART Domains Protein: ENSMUSP00000001186
Gene: ENSMUSG00000001158
AA Change: S18P

DomainStartEndE-ValueType
Pfam:DUF1777 1 151 1.8e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000113683
AA Change: S18P
SMART Domains Protein: ENSMUSP00000109313
Gene: ENSMUSG00000001158
AA Change: S18P

DomainStartEndE-ValueType
Pfam:DUF1777 1 139 1.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204153
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine-rich (SR) protein. SR proteins play important roles in pre-mRNA splicing by facilitating the recognition and selection of splice sites. The encoded protein associates with the 25S U4/U6.U5 tri-snRNP, a major component of the U2-type spiceosome. The expression of this gene may be altered in cells infected with the human T-cell lymphotropic virus type 1 (HTLV-1) retrovirus. A pseudogene of this gene is located on the long arm of chromosome 5. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Snrnp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02028:Snrnp27 APN 6 86682973 missense unknown
IGL03198:Snrnp27 APN 6 86682986 splice site probably null
PIT4131001:Snrnp27 UTSW 6 86682911 missense unknown
R0136:Snrnp27 UTSW 6 86676205 missense probably benign 0.07
R0242:Snrnp27 UTSW 6 86675593 unclassified probably benign
R0375:Snrnp27 UTSW 6 86680953 missense possibly damaging 0.83
R2164:Snrnp27 UTSW 6 86676214 missense probably benign 0.03
R6042:Snrnp27 UTSW 6 86682920 missense unknown
R7667:Snrnp27 UTSW 6 86680953 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAAGTCAAGGGCATCTCCTGG -3'
(R):5'- AGTGCCTCACAGATGCATG -3'

Sequencing Primer
(F):5'- GGCATCTCCTGGGCTCTTTG -3'
(R):5'- GGCTGGCCTTGAATTCAGAAATCC -3'
Posted On2016-07-06