Incidental Mutation 'R5245:Mcm4'
ID 401128
Institutional Source Beutler Lab
Gene Symbol Mcm4
Ensembl Gene ENSMUSG00000022673
Gene Name minichromosome maintenance complex component 4
Synonyms mCdc21, Mcmd4, 19G, Cdc21
MMRRC Submission 042816-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5245 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 15441761-15455264 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15448289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 423 (T423S)
Ref Sequence ENSEMBL: ENSMUSP00000023353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023353]
AlphaFold P49717
Predicted Effect probably benign
Transcript: ENSMUST00000023353
AA Change: T423S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: T423S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
MCM 266 769 N/A SMART
AAA 501 653 7.04e-3 SMART
Blast:MCM 781 849 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000229606
Predicted Effect probably benign
Transcript: ENSMUST00000230437
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,661,624 (GRCm39) Y270* probably null Het
Akap9 A T 5: 4,026,209 (GRCm39) Q59L probably damaging Het
Aloxe3 A T 11: 69,020,502 (GRCm39) Q182L probably benign Het
Arhgef5 G T 6: 43,242,614 (GRCm39) probably benign Het
Bcas3 T A 11: 85,449,912 (GRCm39) N663K probably damaging Het
Cimap3 T C 3: 105,921,770 (GRCm39) H51R possibly damaging Het
Cntfr A T 4: 41,670,879 (GRCm39) W95R possibly damaging Het
Dcun1d4 A G 5: 73,714,657 (GRCm39) T275A probably benign Het
Eps8l1 A G 7: 4,473,873 (GRCm39) R227G probably damaging Het
Ets2 G A 16: 95,513,304 (GRCm39) W160* probably null Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Fsip2 A G 2: 82,823,505 (GRCm39) M6413V probably benign Het
Gm14401 C T 2: 176,778,471 (GRCm39) P186S probably damaging Het
Hrc G A 7: 44,984,855 (GRCm39) G2D probably damaging Het
Kcnq3 A G 15: 65,903,284 (GRCm39) V142A possibly damaging Het
Lama3 G A 18: 12,552,950 (GRCm39) C454Y probably damaging Het
Lrrk2 A G 15: 91,680,292 (GRCm39) T2068A probably damaging Het
Mab21l2 T C 3: 86,454,799 (GRCm39) E67G possibly damaging Het
Map3k5 G A 10: 20,016,437 (GRCm39) V1343I probably benign Het
Mmp16 A G 4: 18,054,596 (GRCm39) probably benign Het
Nat3 C T 8: 68,000,832 (GRCm39) T237I probably benign Het
Nol4 A T 18: 22,828,179 (GRCm39) *484R probably null Het
Nsmf A G 2: 24,946,119 (GRCm39) E202G probably damaging Het
Olfml2b T C 1: 170,496,443 (GRCm39) V358A probably benign Het
Or2v2 T A 11: 49,004,116 (GRCm39) I146F probably benign Het
Or4b1d T A 2: 89,968,606 (GRCm39) K292N probably damaging Het
Osbpl1a T C 18: 12,891,910 (GRCm39) E466G probably damaging Het
Pim3 A G 15: 88,747,404 (GRCm39) E90G possibly damaging Het
Recql5 T C 11: 115,784,385 (GRCm39) E905G probably damaging Het
Rnf31 T G 14: 55,839,163 (GRCm39) L925R probably damaging Het
Secisbp2l A G 2: 125,589,511 (GRCm39) V679A probably damaging Het
Setdb2 T A 14: 59,663,943 (GRCm39) E68V probably null Het
Shtn1 T A 19: 59,020,652 (GRCm39) N190I possibly damaging Het
Slc25a25 G A 2: 32,311,340 (GRCm39) Q14* probably null Het
Snrnp27 A G 6: 86,659,941 (GRCm39) S18P unknown Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tbx5 T C 5: 120,021,230 (GRCm39) V412A possibly damaging Het
Tcea3 A G 4: 135,991,813 (GRCm39) T166A probably benign Het
Tdrp A T 8: 14,024,479 (GRCm39) probably benign Het
Tent5a G T 9: 85,208,401 (GRCm39) Q160K possibly damaging Het
Tmem132e T C 11: 82,333,464 (GRCm39) V624A probably damaging Het
Tnnt1 T C 7: 4,513,066 (GRCm39) D72G probably damaging Het
Trim80 C A 11: 115,332,398 (GRCm39) H197N probably damaging Het
Zfp322a A T 13: 23,541,156 (GRCm39) C195* probably null Het
Zfp335 A G 2: 164,736,678 (GRCm39) S986P probably benign Het
Other mutations in Mcm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Mcm4 APN 16 15,443,995 (GRCm39) missense probably damaging 1.00
IGL01982:Mcm4 APN 16 15,448,284 (GRCm39) missense possibly damaging 0.57
IGL02382:Mcm4 APN 16 15,442,602 (GRCm39) missense probably damaging 1.00
PIT4687001:Mcm4 UTSW 16 15,454,577 (GRCm39) missense probably benign 0.01
R0200:Mcm4 UTSW 16 15,447,503 (GRCm39) missense probably benign 0.41
R0540:Mcm4 UTSW 16 15,449,979 (GRCm39) critical splice donor site probably null
R0607:Mcm4 UTSW 16 15,449,979 (GRCm39) critical splice donor site probably null
R2064:Mcm4 UTSW 16 15,452,333 (GRCm39) missense possibly damaging 0.75
R4240:Mcm4 UTSW 16 15,445,570 (GRCm39) nonsense probably null
R4604:Mcm4 UTSW 16 15,447,527 (GRCm39) missense probably damaging 1.00
R4871:Mcm4 UTSW 16 15,452,374 (GRCm39) nonsense probably null
R5070:Mcm4 UTSW 16 15,443,434 (GRCm39) missense probably damaging 1.00
R5125:Mcm4 UTSW 16 15,453,167 (GRCm39) missense probably benign 0.21
R5178:Mcm4 UTSW 16 15,453,167 (GRCm39) missense probably benign 0.21
R5513:Mcm4 UTSW 16 15,448,378 (GRCm39) missense probably benign 0.26
R5696:Mcm4 UTSW 16 15,443,434 (GRCm39) missense probably damaging 1.00
R6453:Mcm4 UTSW 16 15,448,273 (GRCm39) missense probably damaging 1.00
R6753:Mcm4 UTSW 16 15,447,226 (GRCm39) missense possibly damaging 0.91
R6909:Mcm4 UTSW 16 15,446,561 (GRCm39) missense probably damaging 1.00
R6937:Mcm4 UTSW 16 15,454,199 (GRCm39) missense probably benign
R7402:Mcm4 UTSW 16 15,455,042 (GRCm39) start codon destroyed probably null
R7483:Mcm4 UTSW 16 15,448,306 (GRCm39) missense probably benign 0.05
R8275:Mcm4 UTSW 16 15,452,435 (GRCm39) missense probably damaging 0.98
R8487:Mcm4 UTSW 16 15,450,042 (GRCm39) missense probably damaging 1.00
R8683:Mcm4 UTSW 16 15,453,138 (GRCm39) missense probably damaging 0.99
R8742:Mcm4 UTSW 16 15,443,430 (GRCm39) missense possibly damaging 0.52
R8929:Mcm4 UTSW 16 15,448,289 (GRCm39) missense probably benign 0.02
R9138:Mcm4 UTSW 16 15,447,200 (GRCm39) missense probably damaging 1.00
R9440:Mcm4 UTSW 16 15,453,175 (GRCm39) nonsense probably null
Z1177:Mcm4 UTSW 16 15,450,080 (GRCm39) missense possibly damaging 0.55
Z1177:Mcm4 UTSW 16 15,447,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAACAGTTCCTACCCATAG -3'
(R):5'- GTGCTCAAGTGAGATGGAGC -3'

Sequencing Primer
(F):5'- CTACCCATAGAAGACAGTAACAGTGG -3'
(R):5'- AGCCCCCAGGTCTGACC -3'
Posted On 2016-07-06