Incidental Mutation 'R5301:Epcam'
ID404272
Institutional Source Beutler Lab
Gene Symbol Epcam
Ensembl Gene ENSMUSG00000045394
Gene Nameepithelial cell adhesion molecule
SynonymsGA733-2, Egp314, EpCAM, gp40, Ly74, EGP-2, CD326, panepithelial glycoprotein 314, TROP1, Ep-CAM, EpCAM1, Tacstd1
MMRRC Submission 042884-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5301 (G1)
Quality Score143
Status Validated
Chromosome17
Chromosomal Location87635979-87651106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87636877 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 20 (L20Q)
Ref Sequence ENSEMBL: ENSMUSP00000061935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053577
AA Change: L20Q

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394
AA Change: L20Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with decreased embryo size, impaired labyrinth layer development and decreased number of trophoblast giant cells. Mice homozygous for another knock-out allele exhibit impaired intestinal tight junctions with lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,102,853 V578A probably damaging Het
Abcb11 T C 2: 69,286,847 I486V probably damaging Het
Abcc9 G A 6: 142,590,481 T1509I probably benign Het
Akr1c20 T A 13: 4,523,280 D12V probably damaging Het
Asb1 A G 1: 91,554,753 Y66C probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Bcl10 A G 3: 145,930,587 D80G probably damaging Het
Bdnf T C 2: 109,723,539 V46A probably benign Het
Cyp11a1 A G 9: 58,019,261 probably benign Het
Cyp3a44 A G 5: 145,788,516 S292P probably damaging Het
Desi2 A G 1: 178,244,386 I85M probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock10 T C 1: 80,648,256 D49G probably benign Het
Ercc4 T C 16: 13,130,686 V589A probably damaging Het
Fcgbp A T 7: 28,093,674 K1034N possibly damaging Het
Fras1 C T 5: 96,657,266 L1256F possibly damaging Het
Gata5 T C 2: 180,333,993 Y126C probably damaging Het
Gja1 T C 10: 56,388,379 L278P probably damaging Het
Gm11596 C A 11: 99,793,021 R91L unknown Het
Gm29125 A T 1: 80,384,437 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hcrtr1 G T 4: 130,137,670 probably null Het
Ifi207 G A 1: 173,729,411 S587L possibly damaging Het
Ino80d T C 1: 63,074,419 T291A probably benign Het
Itgb3 A G 11: 104,633,654 probably null Het
Kif26b A G 1: 178,530,668 S115G unknown Het
Klc3 T C 7: 19,396,349 Y301C probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Meioc A T 11: 102,680,045 R867S probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mthfd2 C A 6: 83,310,483 G200V probably damaging Het
Nrap A G 19: 56,379,109 I312T probably damaging Het
Nrp1 T G 8: 128,434,197 probably null Het
Obscn A G 11: 59,135,408 L323P probably damaging Het
Olfr1499 G A 19: 13,815,569 T7I probably damaging Het
Olfr362 C T 2: 37,105,198 V151M probably benign Het
Olfr738 T C 14: 50,413,573 S10P probably benign Het
Pkn2 A C 3: 142,839,206 probably null Het
Ppp1r18 A G 17: 35,868,345 R371G probably benign Het
Prkar2b A C 12: 31,975,928 V31G probably damaging Het
Reg3b T A 6: 78,371,260 M19K probably damaging Het
Sec14l2 G A 11: 4,118,727 probably benign Het
Sgca C T 11: 94,963,331 R104Q probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Sorcs2 A G 5: 36,039,390 V637A probably damaging Het
Tdrd9 T A 12: 112,036,529 probably null Het
Tmem181a T C 17: 6,295,795 I229T possibly damaging Het
Tmpo A T 10: 91,149,788 probably benign Het
Ttc41 T C 10: 86,719,520 V280A probably benign Het
Vmn1r234 G T 17: 21,229,327 V168F probably benign Het
Vmn2r96 T A 17: 18,597,688 I701N probably damaging Het
Wnt16 T A 6: 22,297,849 M238K probably damaging Het
Zfp607b A G 7: 27,703,747 T543A probably benign Het
Other mutations in Epcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02739:Epcam APN 17 87640494 missense probably benign 0.30
R0664:Epcam UTSW 17 87639970 missense possibly damaging 0.86
R1612:Epcam UTSW 17 87639938 missense possibly damaging 0.87
R1693:Epcam UTSW 17 87639896 missense probably benign
R1719:Epcam UTSW 17 87642128 missense probably damaging 1.00
R1998:Epcam UTSW 17 87640474 missense probably damaging 1.00
R3872:Epcam UTSW 17 87639926 missense possibly damaging 0.79
R4297:Epcam UTSW 17 87640534 splice site probably null
R4298:Epcam UTSW 17 87640534 splice site probably null
R4866:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R4900:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R5091:Epcam UTSW 17 87642152 missense probably damaging 1.00
R6207:Epcam UTSW 17 87640436 missense probably damaging 1.00
R7576:Epcam UTSW 17 87640293 missense probably damaging 1.00
R7751:Epcam UTSW 17 87640476 nonsense probably null
R7795:Epcam UTSW 17 87643555 missense probably benign 0.08
R8022:Epcam UTSW 17 87646308 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGGTTTGACTTGGTATCCC -3'
(R):5'- TGGAACCCCAAGTTGGAGTC -3'

Sequencing Primer
(F):5'- GTACTGGAATCCCCGCCTCTG -3'
(R):5'- CCAGACCTGGGGCGGTG -3'
Posted On2016-07-22