Incidental Mutation 'R5301:Zfp607b'
ID 404245
Institutional Source Beutler Lab
Gene Symbol Zfp607b
Ensembl Gene ENSMUSG00000057093
Gene Name zinc finger protein 607B
Synonyms C030039L03Rik
MMRRC Submission 042884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R5301 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27689340-27706484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27703747 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 543 (T543A)
Ref Sequence ENSEMBL: ENSMUSP00000112494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076421] [ENSMUST00000120004]
AlphaFold G3X9H3
Predicted Effect probably benign
Transcript: ENSMUST00000076421
AA Change: T543A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075755
Gene: ENSMUSG00000057093
AA Change: T543A

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120004
AA Change: T543A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112494
Gene: ENSMUSG00000057093
AA Change: T543A

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124397
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (52/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,102,853 V578A probably damaging Het
Abcb11 T C 2: 69,286,847 I486V probably damaging Het
Abcc9 G A 6: 142,590,481 T1509I probably benign Het
Akr1c20 T A 13: 4,523,280 D12V probably damaging Het
Asb1 A G 1: 91,554,753 Y66C probably damaging Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Bcl10 A G 3: 145,930,587 D80G probably damaging Het
Bdnf T C 2: 109,723,539 V46A probably benign Het
Cyp11a1 A G 9: 58,019,261 probably benign Het
Cyp3a44 A G 5: 145,788,516 S292P probably damaging Het
Desi2 A G 1: 178,244,386 I85M probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock10 T C 1: 80,648,256 D49G probably benign Het
Epcam T A 17: 87,636,877 L20Q possibly damaging Het
Ercc4 T C 16: 13,130,686 V589A probably damaging Het
Fcgbp A T 7: 28,093,674 K1034N possibly damaging Het
Fras1 C T 5: 96,657,266 L1256F possibly damaging Het
Gata5 T C 2: 180,333,993 Y126C probably damaging Het
Gja1 T C 10: 56,388,379 L278P probably damaging Het
Gm11596 C A 11: 99,793,021 R91L unknown Het
Gm29125 A T 1: 80,384,437 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Hcrtr1 G T 4: 130,137,670 probably null Het
Ifi207 G A 1: 173,729,411 S587L possibly damaging Het
Ino80d T C 1: 63,074,419 T291A probably benign Het
Itgb3 A G 11: 104,633,654 probably null Het
Kif26b A G 1: 178,530,668 S115G unknown Het
Klc3 T C 7: 19,396,349 Y301C probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Meioc A T 11: 102,680,045 R867S probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mthfd2 C A 6: 83,310,483 G200V probably damaging Het
Nrap A G 19: 56,379,109 I312T probably damaging Het
Nrp1 T G 8: 128,434,197 probably null Het
Obscn A G 11: 59,135,408 L323P probably damaging Het
Olfr1499 G A 19: 13,815,569 T7I probably damaging Het
Olfr362 C T 2: 37,105,198 V151M probably benign Het
Olfr738 T C 14: 50,413,573 S10P probably benign Het
Pkn2 A C 3: 142,839,206 probably null Het
Ppp1r18 A G 17: 35,868,345 R371G probably benign Het
Prkar2b A C 12: 31,975,928 V31G probably damaging Het
Reg3b T A 6: 78,371,260 M19K probably damaging Het
Sec14l2 G A 11: 4,118,727 probably benign Het
Sgca C T 11: 94,963,331 R104Q probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Sorcs2 A G 5: 36,039,390 V637A probably damaging Het
Tdrd9 T A 12: 112,036,529 probably null Het
Tmem181a T C 17: 6,295,795 I229T possibly damaging Het
Tmpo A T 10: 91,149,788 probably benign Het
Ttc41 T C 10: 86,719,520 V280A probably benign Het
Vmn1r234 G T 17: 21,229,327 V168F probably benign Het
Vmn2r96 T A 17: 18,597,688 I701N probably damaging Het
Wnt16 T A 6: 22,297,849 M238K probably damaging Het
Other mutations in Zfp607b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Zfp607b APN 7 27698715 missense possibly damaging 0.75
IGL02114:Zfp607b APN 7 27703725 missense probably benign 0.19
IGL03171:Zfp607b APN 7 27693595 missense possibly damaging 0.70
IGL03329:Zfp607b APN 7 27703870 missense probably damaging 1.00
R0988:Zfp607b UTSW 7 27702976 missense probably benign 0.34
R1518:Zfp607b UTSW 7 27698662 missense possibly damaging 0.95
R1672:Zfp607b UTSW 7 27692523 missense possibly damaging 0.86
R1733:Zfp607b UTSW 7 27692524 missense possibly damaging 0.66
R1992:Zfp607b UTSW 7 27702524 missense possibly damaging 0.87
R2849:Zfp607b UTSW 7 27702394 missense probably benign 0.00
R3879:Zfp607b UTSW 7 27704051 missense possibly damaging 0.91
R4117:Zfp607b UTSW 7 27698682 missense probably damaging 0.97
R4439:Zfp607b UTSW 7 27702724 missense probably damaging 1.00
R4610:Zfp607b UTSW 7 27703695 missense probably damaging 1.00
R4755:Zfp607b UTSW 7 27703505 missense probably damaging 1.00
R4909:Zfp607b UTSW 7 27703796 missense probably benign
R5095:Zfp607b UTSW 7 27693636 intron probably benign
R5422:Zfp607b UTSW 7 27702388 missense probably benign 0.00
R5538:Zfp607b UTSW 7 27702869 missense probably damaging 1.00
R5546:Zfp607b UTSW 7 27702607 missense probably benign 0.19
R5644:Zfp607b UTSW 7 27703769 missense probably damaging 1.00
R5649:Zfp607b UTSW 7 27703981 missense probably damaging 1.00
R5692:Zfp607b UTSW 7 27703464 missense probably benign 0.17
R5945:Zfp607b UTSW 7 27702416 missense probably benign 0.06
R6695:Zfp607b UTSW 7 27704039 missense probably benign 0.04
R7402:Zfp607b UTSW 7 27693494 missense probably damaging 1.00
R7515:Zfp607b UTSW 7 27703496 missense probably benign 0.03
R8402:Zfp607b UTSW 7 27702702 missense probably damaging 1.00
R8954:Zfp607b UTSW 7 27703962 missense probably benign 0.00
Z1177:Zfp607b UTSW 7 27702394 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACTGGAGAGAAATTGGAATGT -3'
(R):5'- TGACCCACACTGCTCACATT -3'

Sequencing Primer
(F):5'- GGGTCAGCCTTTAGACGTAAATACC -3'
(R):5'- CCACACTGCTCACATTCATATG -3'
Posted On 2016-07-22