Incidental Mutation 'R5286:Zbtb2'
ID424362
Institutional Source Beutler Lab
Gene Symbol Zbtb2
Ensembl Gene ENSMUSG00000075327
Gene Namezinc finger and BTB domain containing 2
SynonymsLOC381990
MMRRC Submission 042870-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R5286 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location4367075-4388108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4368566 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 487 (G487S)
Ref Sequence ENSEMBL: ENSMUSP00000097656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100077] [ENSMUST00000100078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100077
AA Change: G487S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097655
Gene: ENSMUSG00000075327
AA Change: G487S

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100078
AA Change: G487S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097656
Gene: ENSMUSG00000075327
AA Change: G487S

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215860
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,295 I417V probably benign Het
Adad1 T C 3: 37,065,250 V160A possibly damaging Het
Adcy7 A G 8: 88,324,859 E869G probably damaging Het
Birc6 G A 17: 74,670,247 A4352T probably damaging Het
Brd2 T A 17: 34,115,231 T286S probably damaging Het
Bsn G T 9: 108,110,924 probably benign Het
Cables1 A G 18: 11,924,827 T335A probably benign Het
Cacna1d A T 14: 30,350,725 S98T possibly damaging Het
Ccdc181 A G 1: 164,278,241 Y15C probably damaging Het
Dlgap4 T G 2: 156,745,919 V39G probably damaging Het
Epb41l3 G A 17: 69,262,273 R504H probably benign Het
Fbxo7 T C 10: 86,022,090 L23P probably damaging Het
Gm42791 A C 5: 148,950,368 probably benign Het
Gprc5b A T 7: 118,983,687 F320I possibly damaging Het
Gtf3c1 G A 7: 125,663,408 T1093M possibly damaging Het
Hddc3 G T 7: 80,343,795 R83L probably damaging Het
Hspb11 T A 4: 107,279,801 I132N probably damaging Het
Iars2 T C 1: 185,323,121 probably benign Het
Igfn1 T C 1: 135,967,861 K1656E probably benign Het
Itk A C 11: 46,338,099 probably null Het
Klra6 G A 6: 130,018,969 T142I probably benign Het
Knop1 C T 7: 118,855,770 A3T probably damaging Het
Lamc3 A G 2: 31,918,596 H788R probably damaging Het
Lrif1 A G 3: 106,732,543 R315G probably damaging Het
Mfap3l A G 8: 60,656,869 D93G probably benign Het
Ngef T C 1: 87,545,830 S77G probably benign Het
Nt5dc3 T C 10: 86,804,792 S13P probably benign Het
Olfr12 T C 1: 92,620,362 V152A probably benign Het
Pclo T C 5: 14,679,747 probably benign Het
Pkhd1l1 C T 15: 44,514,972 Q1041* probably null Het
Ppl G A 16: 5,089,123 R1103* probably null Het
Ppp4r3b T A 11: 29,211,667 D680E probably benign Het
Rasgrf2 T G 13: 92,131,433 K21T possibly damaging Het
Rev1 T A 1: 38,055,326 K1004* probably null Het
Rgs9 T G 11: 109,239,451 probably null Het
Rnf31 T C 14: 55,592,236 L86P probably damaging Het
Rps13 A G 7: 116,333,920 Y18H probably damaging Het
Rxfp2 T C 5: 150,035,444 F33S probably damaging Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Stard9 T A 2: 120,701,947 V2895D probably benign Het
Syn3 T C 10: 86,351,564 N232S possibly damaging Het
Taok3 T A 5: 117,266,075 Y772N probably damaging Het
Tspan4 A G 7: 141,482,570 probably null Het
Ttn C A 2: 76,854,186 probably benign Het
Vwa3b T A 1: 37,045,039 W98R probably damaging Het
Vwa5b2 A T 16: 20,596,308 D360V probably damaging Het
Wdr73 A T 7: 80,891,809 D328E probably benign Het
Xpo5 A G 17: 46,234,480 N824S probably benign Het
Other mutations in Zbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Zbtb2 APN 10 4369702 missense probably benign 0.28
IGL02340:Zbtb2 APN 10 4368712 missense probably damaging 0.98
PIT4142001:Zbtb2 UTSW 10 4369493 missense probably benign 0.00
PIT4581001:Zbtb2 UTSW 10 4369265 missense possibly damaging 0.77
R1436:Zbtb2 UTSW 10 4368697 missense probably benign 0.01
R2015:Zbtb2 UTSW 10 4369757 missense possibly damaging 0.94
R2570:Zbtb2 UTSW 10 4368673 missense probably damaging 1.00
R5134:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5275:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5295:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5328:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5475:Zbtb2 UTSW 10 4369275 missense probably benign 0.18
R5719:Zbtb2 UTSW 10 4369456 missense probably benign 0.22
R5907:Zbtb2 UTSW 10 4368592 missense possibly damaging 0.52
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6492:Zbtb2 UTSW 10 4369711 missense probably damaging 1.00
R7016:Zbtb2 UTSW 10 4368646 missense probably damaging 1.00
R7287:Zbtb2 UTSW 10 4368986 missense possibly damaging 0.77
R7348:Zbtb2 UTSW 10 4374574 missense possibly damaging 0.48
R7486:Zbtb2 UTSW 10 4369025 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATTTGTATCATGCCATGGAG -3'
(R):5'- GTGCCTCAACCAGAGCATTG -3'

Sequencing Primer
(F):5'- GTATCATGCCATGGAGAAACTGTCC -3'
(R):5'- CAAGCAGACACTGGAGCTCTG -3'
Posted On2016-08-04