Incidental Mutation 'R7287:Zbtb2'
ID566108
Institutional Source Beutler Lab
Gene Symbol Zbtb2
Ensembl Gene ENSMUSG00000075327
Gene Namezinc finger and BTB domain containing 2
SynonymsLOC381990
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R7287 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location4367075-4388108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4368986 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 347 (D347N)
Ref Sequence ENSEMBL: ENSMUSP00000097655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100077] [ENSMUST00000100078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100077
AA Change: D347N

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097655
Gene: ENSMUSG00000075327
AA Change: D347N

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100078
AA Change: D347N

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097656
Gene: ENSMUSG00000075327
AA Change: D347N

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Ap5z1 T C 5: 142,474,047 L484P probably damaging Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cntn1 T A 15: 92,245,952 probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Fgf15 A T 7: 144,896,794 D39V probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Herc6 A G 6: 57,651,980 probably null Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Ido2 T C 8: 24,535,138 probably null Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Lrriq1 A T 10: 103,216,016 Y292N probably benign Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Secisbp2l A G 2: 125,740,369 S1056P probably benign Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tnrc6b A G 15: 80,879,541 T415A possibly damaging Het
Tonsl T C 15: 76,633,725 probably null Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vmn2r68 T C 7: 85,222,252 T608A probably benign Het
Vwf A G 6: 125,637,467 I1104V Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Zbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Zbtb2 APN 10 4369702 missense probably benign 0.28
IGL02340:Zbtb2 APN 10 4368712 missense probably damaging 0.98
PIT4142001:Zbtb2 UTSW 10 4369493 missense probably benign 0.00
PIT4581001:Zbtb2 UTSW 10 4369265 missense possibly damaging 0.77
R1436:Zbtb2 UTSW 10 4368697 missense probably benign 0.01
R2015:Zbtb2 UTSW 10 4369757 missense possibly damaging 0.94
R2570:Zbtb2 UTSW 10 4368673 missense probably damaging 1.00
R5134:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5275:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5286:Zbtb2 UTSW 10 4368566 missense possibly damaging 0.66
R5295:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5328:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5475:Zbtb2 UTSW 10 4369275 missense probably benign 0.18
R5719:Zbtb2 UTSW 10 4369456 missense probably benign 0.22
R5907:Zbtb2 UTSW 10 4368592 missense possibly damaging 0.52
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6492:Zbtb2 UTSW 10 4369711 missense probably damaging 1.00
R7016:Zbtb2 UTSW 10 4368646 missense probably damaging 1.00
R7348:Zbtb2 UTSW 10 4374574 missense possibly damaging 0.48
R7486:Zbtb2 UTSW 10 4369025 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTGGCCCTACAGAAGCTCTTG -3'
(R):5'- TACTATGCCTGCCACCTGTG -3'

Sequencing Primer
(F):5'- CTACAGAAGCTCTTGTCACAGGTG -3'
(R):5'- AGATCCACACCGGGGTAC -3'
Posted On2019-06-26