Incidental Mutation 'R5295:Zbtb2'
ID405363
Institutional Source Beutler Lab
Gene Symbol Zbtb2
Ensembl Gene ENSMUSG00000075327
Gene Namezinc finger and BTB domain containing 2
SynonymsLOC381990
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location4367075-4388108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4368508 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 506 (K506R)
Ref Sequence ENSEMBL: ENSMUSP00000097656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100077] [ENSMUST00000100078]
Predicted Effect probably damaging
Transcript: ENSMUST00000100077
AA Change: K506R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097655
Gene: ENSMUSG00000075327
AA Change: K506R

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100078
AA Change: K506R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097656
Gene: ENSMUSG00000075327
AA Change: K506R

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215860
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Zbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Zbtb2 APN 10 4369702 missense probably benign 0.28
IGL02340:Zbtb2 APN 10 4368712 missense probably damaging 0.98
PIT4142001:Zbtb2 UTSW 10 4369493 missense probably benign 0.00
PIT4581001:Zbtb2 UTSW 10 4369265 missense possibly damaging 0.77
R1436:Zbtb2 UTSW 10 4368697 missense probably benign 0.01
R2015:Zbtb2 UTSW 10 4369757 missense possibly damaging 0.94
R2570:Zbtb2 UTSW 10 4368673 missense probably damaging 1.00
R5134:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5275:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5286:Zbtb2 UTSW 10 4368566 missense possibly damaging 0.66
R5328:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5475:Zbtb2 UTSW 10 4369275 missense probably benign 0.18
R5719:Zbtb2 UTSW 10 4369456 missense probably benign 0.22
R5907:Zbtb2 UTSW 10 4368592 missense possibly damaging 0.52
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6492:Zbtb2 UTSW 10 4369711 missense probably damaging 1.00
R7016:Zbtb2 UTSW 10 4368646 missense probably damaging 1.00
R7287:Zbtb2 UTSW 10 4368986 missense possibly damaging 0.77
R7348:Zbtb2 UTSW 10 4374574 missense possibly damaging 0.48
R7486:Zbtb2 UTSW 10 4369025 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTACTACTGACCATTATCCTTCC -3'
(R):5'- TGCAACCTGTGTGACAAGAC -3'

Sequencing Primer
(F):5'- GTTCAGGATTATAATGCACAAAGCC -3'
(R):5'- AACCTGTGTGACAAGACGTTCTC -3'
Posted On2016-07-22