Incidental Mutation 'R5380:Spata21'
ID425793
Institutional Source Beutler Lab
Gene Symbol Spata21
Ensembl Gene ENSMUSG00000045004
Gene Namespermatogenesis associated 21
Synonyms
MMRRC Submission 042955-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5380 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141088333-141112760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141107185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 494 (T494A)
Ref Sequence ENSEMBL: ENSMUSP00000053080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051907]
Predicted Effect probably damaging
Transcript: ENSMUST00000051907
AA Change: T494A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053080
Gene: ENSMUSG00000045004
AA Change: T494A

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 245 251 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
SCOP:d1mr8a_ 428 494 7e-13 SMART
PDB:2RRT|A 432 494 2e-7 PDB
low complexity region 524 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181353
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012P22Rik A T 4: 144,423,802 W70R probably damaging Het
Aco1 A T 4: 40,177,848 I290F probably damaging Het
Cmip T A 8: 117,422,890 C155S probably damaging Het
Cyba G T 8: 122,426,979 P82T possibly damaging Het
Dgkb C T 12: 38,127,300 R202W possibly damaging Het
Dnah6 T C 6: 73,037,615 E3611G probably damaging Het
Dnah7b A T 1: 46,217,191 S1885C probably benign Het
Dopey2 A G 16: 93,763,410 E748G probably damaging Het
Dusp18 C A 11: 3,897,037 P9Q probably damaging Het
Fat4 T A 3: 38,888,864 D635E probably damaging Het
Fbxo25 T A 8: 13,921,886 S79R probably benign Het
Fgfr4 T A 13: 55,167,417 L675Q probably damaging Het
Foxo1 T A 3: 52,269,025 L75Q probably damaging Het
Fsip2 T C 2: 82,975,398 V687A possibly damaging Het
Gga3 G T 11: 115,588,431 P354Q probably damaging Het
Gm11077 A T 6: 140,729,322 K13N unknown Het
Haus4 T A 14: 54,549,775 K75M probably damaging Het
Igfn1 G A 1: 135,966,087 T2085M probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lims1 A T 10: 58,416,670 I321L probably damaging Het
Ms4a6b A T 19: 11,521,680 I53F probably damaging Het
Msl3l2 A G 10: 56,115,572 D131G probably damaging Het
Nrap A G 19: 56,381,603 V189A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pfkl T G 10: 77,997,589 I260L possibly damaging Het
Pkd2l1 A G 19: 44,157,732 Y128H probably benign Het
Prpf6 T A 2: 181,608,266 L73Q probably damaging Het
R3hdm2 T C 10: 127,485,447 V658A probably damaging Het
Rab27b T C 18: 69,996,155 T23A probably damaging Het
Rabif A G 1: 134,506,242 E98G probably damaging Het
Ror2 T C 13: 53,117,149 D378G possibly damaging Het
Ssh2 A G 11: 77,453,945 K919E probably benign Het
Tnrc6b C G 15: 80,879,565 P423A possibly damaging Het
Tomm40 A G 7: 19,701,750 F352L probably benign Het
Tsg101 A T 7: 46,891,120 D158E probably damaging Het
Tspo2 A G 17: 48,448,752 F93L probably benign Het
V1ra8 T A 6: 90,203,022 I69K probably damaging Het
Zan T C 5: 137,457,840 T1353A unknown Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp281 A G 1: 136,625,938 K218R possibly damaging Het
Other mutations in Spata21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Spata21 APN 4 141111364 unclassified probably null
IGL02679:Spata21 APN 4 141111265 unclassified probably benign
R1772:Spata21 UTSW 4 141111296 missense possibly damaging 0.79
R1894:Spata21 UTSW 4 141111381 missense possibly damaging 0.53
R1950:Spata21 UTSW 4 141111405 missense probably damaging 0.99
R2015:Spata21 UTSW 4 141107329 nonsense probably null
R2093:Spata21 UTSW 4 141096966 missense probably benign 0.04
R2911:Spata21 UTSW 4 141103082 missense possibly damaging 0.46
R4809:Spata21 UTSW 4 141097120 critical splice donor site probably null
R4897:Spata21 UTSW 4 141104950 missense probably damaging 0.99
R4907:Spata21 UTSW 4 141097121 critical splice donor site probably null
R4921:Spata21 UTSW 4 141112091 missense probably damaging 1.00
R5269:Spata21 UTSW 4 141103021 missense probably damaging 1.00
R5602:Spata21 UTSW 4 141096899 missense probably benign
R6982:Spata21 UTSW 4 141096873 missense possibly damaging 0.71
R7503:Spata21 UTSW 4 141095303 missense probably benign 0.05
R7809:Spata21 UTSW 4 141104043 missense probably null 0.83
R8072:Spata21 UTSW 4 141112006 nonsense probably null
Z1177:Spata21 UTSW 4 141098002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCGTCACGGTTACAAG -3'
(R):5'- AGCATTTCCACCAGCAGAG -3'

Sequencing Primer
(F):5'- TCACGGTTACAAGCCCTGG -3'
(R):5'- TTTCCACCAGCAGAGAGAGGATC -3'
Posted On2016-08-04