Mutagenetix > Incidental Mutations

Incidental Mutation 'R5380:Ror2'

425820

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

042955-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5380 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53117149 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 378 (D378G)

Ref Sequence

ENSEMBL: ENSMUSP00000123362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021918
AA Change: D390G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: D390G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130235
AA Change: D378G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: D378G

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012P22Rik	A	T	4: 144,423,802	W70R	probably damaging	Het
Aco1	A	T	4: 40,177,848	I290F	probably damaging	Het
Cmip	T	A	8: 117,422,890	C155S	probably damaging	Het
Cyba	G	T	8: 122,426,979	P82T	possibly damaging	Het
Dgkb	C	T	12: 38,127,300	R202W	possibly damaging	Het
Dnah6	T	C	6: 73,037,615	E3611G	probably damaging	Het
Dnah7b	A	T	1: 46,217,191	S1885C	probably benign	Het
Dopey2	A	G	16: 93,763,410	E748G	probably damaging	Het
Dusp18	C	A	11: 3,897,037	P9Q	probably damaging	Het
Fat4	T	A	3: 38,888,864	D635E	probably damaging	Het
Fbxo25	T	A	8: 13,921,886	S79R	probably benign	Het
Fgfr4	T	A	13: 55,167,417	L675Q	probably damaging	Het
Foxo1	T	A	3: 52,269,025	L75Q	probably damaging	Het
Fsip2	T	C	2: 82,975,398	V687A	possibly damaging	Het
Gga3	G	T	11: 115,588,431	P354Q	probably damaging	Het
Gm11077	A	T	6: 140,729,322	K13N	unknown	Het
Haus4	T	A	14: 54,549,775	K75M	probably damaging	Het
Igfn1	G	A	1: 135,966,087	T2085M	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Lims1	A	T	10: 58,416,670	I321L	probably damaging	Het
Ms4a6b	A	T	19: 11,521,680	I53F	probably damaging	Het
Msl3l2	A	G	10: 56,115,572	D131G	probably damaging	Het
Nrap	A	G	19: 56,381,603	V189A	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pfkl	T	G	10: 77,997,589	I260L	possibly damaging	Het
Pkd2l1	A	G	19: 44,157,732	Y128H	probably benign	Het
Prpf6	T	A	2: 181,608,266	L73Q	probably damaging	Het
R3hdm2	T	C	10: 127,485,447	V658A	probably damaging	Het
Rab27b	T	C	18: 69,996,155	T23A	probably damaging	Het
Rabif	A	G	1: 134,506,242	E98G	probably damaging	Het
Spata21	A	G	4: 141,107,185	T494A	probably damaging	Het
Ssh2	A	G	11: 77,453,945	K919E	probably benign	Het
Tnrc6b	C	G	15: 80,879,565	P423A	possibly damaging	Het
Tomm40	A	G	7: 19,701,750	F352L	probably benign	Het
Tsg101	A	T	7: 46,891,120	D158E	probably damaging	Het
Tspo2	A	G	17: 48,448,752	F93L	probably benign	Het
V1ra8	T	A	6: 90,203,022	I69K	probably damaging	Het
Zan	T	C	5: 137,457,840	T1353A	unknown	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfp281	A	G	1: 136,625,938	K218R	possibly damaging	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
lavage	UTSW	13	53118982	missense	probably damaging	1.00
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7092:Ror2	UTSW	13	53110236	missense	probably benign
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00
R8031:Ror2	UTSW	13	53113157	missense	probably damaging	1.00
R8479:Ror2	UTSW	13	53117364	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGCACAGCAGTCAGACTTTTC -3'
(R):5'- ATGGCCAGTACCACCAAGTC -3'

Sequencing Primer
(F):5'- GCACAGCAGTCAGACTTTTCTTAGC -3'
(R):5'- AAGTCAGGCCACCAGTGTCAG -3'

Posted On

2016-08-04