Incidental Mutation 'R5420:Rdh16f2'
ID427999
Institutional Source Beutler Lab
Gene Symbol Rdh16f2
Ensembl Gene ENSMUSG00000074639
Gene NameRDH16 family member 2
SynonymsBC089597
MMRRC Submission 042988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5420 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127866474-127877317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127877074 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 314 (P314S)
Ref Sequence ENSEMBL: ENSMUSP00000089691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092058
AA Change: P314S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089691
Gene: ENSMUSG00000074639
AA Change: P314S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 221 4.8e-44 PFAM
Pfam:KR 31 206 4e-7 PFAM
Pfam:DUF1776 43 304 6.8e-10 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 TGCGCAGC T 19: 4,865,344 probably null Het
Adamts1 A T 16: 85,799,609 C117* probably null Het
Adgrg6 A T 10: 14,426,986 Y894* probably null Het
Akap2 G A 4: 57,856,062 V505I probably benign Het
Akap2 T A 4: 57,856,434 Y588N probably damaging Het
Alas1 G T 9: 106,234,159 L603I probably benign Het
Arhgap21 G T 2: 20,881,086 R427S probably damaging Het
Arhgef25 A T 10: 127,187,274 V88D probably benign Het
BC005561 T A 5: 104,518,359 I249N probably damaging Het
Bdp1 T C 13: 100,066,043 Q691R possibly damaging Het
Bpifa6 T A 2: 153,989,330 I272N probably damaging Het
Cacybp T C 1: 160,208,344 probably benign Het
Capn3 T C 2: 120,495,296 probably benign Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cideb A C 14: 55,758,291 M1R probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Crebbp C T 16: 4,107,458 R760H probably damaging Het
Cyp2c23 A C 19: 44,015,664 probably null Het
Cyp3a13 T G 5: 137,898,981 D357A probably damaging Het
Dip2b C T 15: 100,205,173 probably benign Het
Ecm2 A T 13: 49,527,734 R448S possibly damaging Het
Edil3 T C 13: 89,131,772 Y190H probably damaging Het
Eps8l1 T G 7: 4,470,161 probably null Het
Eps8l3 A T 3: 107,883,985 K280* probably null Het
Fam184a A G 10: 53,633,657 F1137L probably damaging Het
Fmn2 A T 1: 174,698,778 R1388* probably null Het
Glt8d2 T C 10: 82,652,682 K318R probably benign Het
Herc2 A T 7: 56,203,830 K3690I probably damaging Het
Ifi206 T A 1: 173,481,033 I466F possibly damaging Het
Jade2 T C 11: 51,818,607 K525R probably benign Het
Kmt2a A T 9: 44,848,336 F772I probably damaging Het
Lipi A G 16: 75,555,869 V360A possibly damaging Het
Mbl1 C T 14: 41,157,196 S108L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mrpl23 A G 7: 142,536,137 T25A probably damaging Het
Mto1 T A 9: 78,452,827 M199K probably benign Het
Nes A T 3: 87,977,002 N812I probably damaging Het
Nfkbie T A 17: 45,560,206 D261E probably benign Het
Olfr866 T C 9: 20,027,059 Y293C probably damaging Het
Papola A G 12: 105,806,495 I114V possibly damaging Het
Pappa T G 4: 65,335,780 probably null Het
Pcdh7 T A 5: 57,720,187 D361E probably damaging Het
Pick1 A G 15: 79,248,840 T367A probably benign Het
Plbd2 A G 5: 120,494,482 Y152H probably damaging Het
Ppfia2 A T 10: 106,835,701 E424D possibly damaging Het
Rab7b C T 1: 131,698,426 T64I probably damaging Het
Rarb T A 14: 16,434,249 I310F possibly damaging Het
Rpain A T 11: 70,977,690 probably null Het
Rufy3 T C 5: 88,640,659 *488Q probably null Het
Sash1 G A 10: 8,746,186 T398I probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn1 T A 6: 54,512,063 I358F probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Thbs1 G T 2: 118,113,155 D85Y possibly damaging Het
Trp53 T C 11: 69,588,320 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn1r223 A G 13: 23,249,505 R90G probably benign Het
Zfp521 A T 18: 13,844,087 Y1090N probably damaging Het
Zfp677 T C 17: 21,397,913 C411R probably damaging Het
Other mutations in Rdh16f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Rdh16f2 APN 10 127866664 missense probably damaging 1.00
IGL00780:Rdh16f2 APN 10 127875092 critical splice donor site probably null
R1448:Rdh16f2 UTSW 10 127876925 missense probably benign
R1757:Rdh16f2 UTSW 10 127876896 missense probably benign 0.01
R2245:Rdh16f2 UTSW 10 127876276 missense probably damaging 1.00
R2484:Rdh16f2 UTSW 10 127875077 missense probably damaging 1.00
R3613:Rdh16f2 UTSW 10 127874939 missense probably benign 0.38
R4828:Rdh16f2 UTSW 10 127874954 missense probably benign 0.09
R5109:Rdh16f2 UTSW 10 127866803 missense probably damaging 1.00
R5153:Rdh16f2 UTSW 10 127876255 missense possibly damaging 0.96
R5448:Rdh16f2 UTSW 10 127877063 missense probably benign 0.03
R5492:Rdh16f2 UTSW 10 127866754 nonsense probably null
R5769:Rdh16f2 UTSW 10 127876889 missense probably benign 0.01
R5863:Rdh16f2 UTSW 10 127876387 missense probably benign
R6003:Rdh16f2 UTSW 10 127876332 missense probably benign 0.02
R6063:Rdh16f2 UTSW 10 127876874 missense probably benign 0.01
R7365:Rdh16f2 UTSW 10 127877024 missense probably damaging 0.98
R7446:Rdh16f2 UTSW 10 127876898 missense probably benign
X0023:Rdh16f2 UTSW 10 127866806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGACCACCTGAATCATTCC -3'
(R):5'- AGATTCCTGTGGTCCCATGTC -3'

Sequencing Primer
(F):5'- CTCATTCTGCATAGATCTGAAAAACC -3'
(R):5'- TGTCCCCCATGTTATACAGAGGAAG -3'
Posted On2016-09-01