Incidental Mutation 'R5498:Yars2'
ID432493
Institutional Source Beutler Lab
Gene Symbol Yars2
Ensembl Gene ENSMUSG00000022792
Gene Nametyrosyl-tRNA synthetase 2 (mitochondrial)
Synonyms2210023C10Rik
MMRRC Submission 043059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5498 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16302965-16309640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16306523 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 331 (H331Q)
Ref Sequence ENSEMBL: ENSMUSP00000055277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059955] [ENSMUST00000159683] [ENSMUST00000159962] [ENSMUST00000162734]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059955
AA Change: H331Q

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055277
Gene: ENSMUSG00000022792
AA Change: H331Q

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 370 5.9e-74 PFAM
Blast:S4 403 466 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159583
Predicted Effect unknown
Transcript: ENSMUST00000159683
AA Change: C320S
SMART Domains Protein: ENSMUSP00000124606
Gene: ENSMUSG00000022792
AA Change: C320S

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159962
AA Change: C320S
SMART Domains Protein: ENSMUSP00000125252
Gene: ENSMUSG00000022792
AA Change: C320S

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161191
Predicted Effect probably benign
Transcript: ENSMUST00000162734
AA Change: C44S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125496
Gene: ENSMUSG00000022792
AA Change: C44S

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 102 7.2e-9 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that catalyzes the attachment of tyrosine to tRNA(Tyr). Mutations in this gene are associated with myopathy with lactic acidosis and sideroblastic anemia type 2 (MLASA2). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,328,240 D928G probably damaging Het
4930522L14Rik T A 5: 109,737,547 K148N probably benign Het
Abca6 T A 11: 110,208,844 D959V possibly damaging Het
Acot12 T C 13: 91,781,233 V393A probably damaging Het
Ano3 C A 2: 110,697,103 V587F possibly damaging Het
Bub1 T C 2: 127,814,709 D471G possibly damaging Het
Cdh15 G T 8: 122,865,178 V601F possibly damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Cnot1 A T 8: 95,757,355 I706N possibly damaging Het
Fbn1 A G 2: 125,360,176 I1259T probably damaging Het
Furin A T 7: 80,391,794 W539R probably damaging Het
Hivep1 A T 13: 42,123,158 probably null Het
Igkv3-9 A G 6: 70,588,743 M109V probably benign Het
Klf10 G A 15: 38,296,039 R421W probably damaging Het
Mtor A T 4: 148,540,364 Y2144F possibly damaging Het
Mybpc2 T C 7: 44,516,265 Y297C probably damaging Het
Myom2 G A 8: 15,129,142 E1325K probably benign Het
Nsd1 A T 13: 55,213,302 K28* probably null Het
Olfr458 C T 6: 42,460,294 A242T probably benign Het
Olfr66 T G 7: 103,881,632 T204P probably damaging Het
Phc2 C A 4: 128,708,994 N120K probably benign Het
Pias3 A G 3: 96,702,188 T274A possibly damaging Het
Plcb4 T A 2: 135,976,172 I786N probably damaging Het
Plec G A 15: 76,177,454 S2626L probably damaging Het
Polg A G 7: 79,454,670 L819P probably damaging Het
Ppp2r3d T C 9: 124,439,123 probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnpc3 A G 3: 113,611,207 probably null Het
Sarnp T A 10: 128,853,194 D65E probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a10 C T 10: 40,037,327 V462M probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn5 A T 11: 82,957,147 H286L possibly damaging Het
Spag17 G A 3: 100,103,345 A2052T possibly damaging Het
Sptbn5 A T 2: 120,076,638 probably benign Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Trim45 T C 3: 100,925,141 V230A possibly damaging Het
Ube3b T C 5: 114,418,574 F989L probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wdr24 A G 17: 25,824,561 H119R probably damaging Het
Zscan21 T C 5: 138,133,260 S349P probably benign Het
Other mutations in Yars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Yars2 APN 16 16303321 missense probably damaging 0.99
IGL01061:Yars2 APN 16 16306542 nonsense probably null
IGL01062:Yars2 APN 16 16306542 nonsense probably null
IGL01063:Yars2 APN 16 16306542 nonsense probably null
IGL01066:Yars2 APN 16 16306542 nonsense probably null
IGL01069:Yars2 APN 16 16306542 nonsense probably null
IGL01070:Yars2 APN 16 16306542 nonsense probably null
IGL02928:Yars2 APN 16 16303546 missense probably damaging 1.00
R4718:Yars2 UTSW 16 16309340 missense probably benign 0.00
R5012:Yars2 UTSW 16 16303584 missense probably damaging 0.98
R5585:Yars2 UTSW 16 16304620 missense probably damaging 1.00
R5935:Yars2 UTSW 16 16309471 missense probably benign 0.02
R6302:Yars2 UTSW 16 16304574 missense probably damaging 1.00
R6344:Yars2 UTSW 16 16303035 missense probably benign
R7218:Yars2 UTSW 16 16303318 missense probably damaging 1.00
R7235:Yars2 UTSW 16 16304692 missense probably benign
X0062:Yars2 UTSW 16 16303018 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTGTATAAGTACATGCTACAGCTTTTC -3'
(R):5'- TGTTCCACAGTATATGTTTCAACAGC -3'

Sequencing Primer
(F):5'- CTTCCCAAGATAAGCTAGTGG -3'
(R):5'- CCCAAGATGTTCTGTGAGCC -3'
Posted On2016-10-05