Incidental Mutation 'R5457:Afg3l1'
ID432824
Institutional Source Beutler Lab
Gene Symbol Afg3l1
Ensembl Gene ENSMUSG00000031967
Gene NameAFG3-like AAA ATPase 1
Synonyms3110061K15Rik, 1700047G05Rik
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123477903-123503916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123489968 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 315 (F315L)
Ref Sequence ENSEMBL: ENSMUSP00000095924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001520] [ENSMUST00000098320] [ENSMUST00000127664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001520
AA Change: F315L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001520
Gene: ENSMUSG00000031967
AA Change: F315L

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 1.2e-8 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Pfam:Peptidase_M41 533 736 6.1e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098320
AA Change: F315L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095924
Gene: ENSMUSG00000031967
AA Change: F315L

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 6.5e-9 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no detectable myelination defects or axonal degeneration in the brain and spinal cord and normal mitochondria in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Afg3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Afg3l1 APN 8 123487389 missense probably benign 0.01
IGL01547:Afg3l1 APN 8 123501351 missense probably benign 0.17
IGL01612:Afg3l1 APN 8 123494853 missense probably benign 0.01
IGL01616:Afg3l1 APN 8 123502007 missense probably damaging 1.00
IGL01969:Afg3l1 APN 8 123480431 missense probably damaging 1.00
IGL01996:Afg3l1 APN 8 123501894 missense probably damaging 0.99
IGL02591:Afg3l1 APN 8 123486009 missense probably damaging 1.00
R0370:Afg3l1 UTSW 8 123501554 missense probably damaging 1.00
R1775:Afg3l1 UTSW 8 123492900 missense possibly damaging 0.89
R1817:Afg3l1 UTSW 8 123501931 missense probably damaging 0.99
R2152:Afg3l1 UTSW 8 123494836 missense probably damaging 1.00
R2516:Afg3l1 UTSW 8 123501954 missense probably damaging 0.99
R2844:Afg3l1 UTSW 8 123494939 intron probably benign
R3013:Afg3l1 UTSW 8 123484677 missense probably benign 0.27
R3732:Afg3l1 UTSW 8 123501233 missense probably damaging 1.00
R4565:Afg3l1 UTSW 8 123501869 nonsense probably null
R4603:Afg3l1 UTSW 8 123501935 missense probably benign 0.43
R4888:Afg3l1 UTSW 8 123488326 critical splice donor site probably null
R4932:Afg3l1 UTSW 8 123501380 missense probably damaging 1.00
R4970:Afg3l1 UTSW 8 123498653 missense probably benign 0.04
R5027:Afg3l1 UTSW 8 123489814 missense probably benign 0.00
R5133:Afg3l1 UTSW 8 123489793 missense probably benign 0.16
R5911:Afg3l1 UTSW 8 123500039 missense possibly damaging 0.79
R6268:Afg3l1 UTSW 8 123492926 missense probably damaging 1.00
R7116:Afg3l1 UTSW 8 123489862 missense probably damaging 0.98
R7303:Afg3l1 UTSW 8 123501269 missense probably damaging 1.00
R7646:Afg3l1 UTSW 8 123493027 missense possibly damaging 0.85
Z1088:Afg3l1 UTSW 8 123488242 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCTGGTCCTGGTTAGCATCC -3'
(R):5'- ACCGGCCATTTTACTGGAGG -3'

Sequencing Primer
(F):5'- CCTCCTATATGCTATGAGGAGGG -3'
(R):5'- GAGGGGCTATTTCTGTCCTCC -3'
Posted On2016-10-06