Incidental Mutation 'R5457:Olfr204'
ID432849
Institutional Source Beutler Lab
Gene Symbol Olfr204
Ensembl Gene ENSMUSG00000095928
Gene Nameolfactory receptor 204
SynonymsGA_x54KRFPKG5P-55529713-55528796, MOR182-3
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location59310206-59318248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59314850 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 186 (I186V)
Ref Sequence ENSEMBL: ENSMUSP00000151176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]
Predicted Effect probably benign
Transcript: ENSMUST00000072517
AA Change: I186V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: I186V

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 299 2.3e-9 PFAM
Pfam:7tm_1 40 289 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207927
AA Change: I186V
Predicted Effect probably benign
Transcript: ENSMUST00000216261
AA Change: I186V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Olfr204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr204 APN 16 59314528 missense probably damaging 1.00
IGL01915:Olfr204 APN 16 59315110 missense probably damaging 1.00
R0265:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R0532:Olfr204 UTSW 16 59314601 missense probably benign 0.00
R1719:Olfr204 UTSW 16 59314706 nonsense probably null
R1864:Olfr204 UTSW 16 59315015 missense probably damaging 1.00
R1889:Olfr204 UTSW 16 59314963 missense probably damaging 0.98
R1925:Olfr204 UTSW 16 59314664 missense probably damaging 1.00
R2973:Olfr204 UTSW 16 59315404 start codon destroyed probably null 1.00
R3078:Olfr204 UTSW 16 59314726 missense probably benign
R3819:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R4036:Olfr204 UTSW 16 59314750 missense probably benign
R4698:Olfr204 UTSW 16 59315357 missense probably damaging 1.00
R4930:Olfr204 UTSW 16 59314873 missense probably damaging 1.00
R6597:Olfr204 UTSW 16 59315350 missense probably benign 0.00
R7341:Olfr204 UTSW 16 59315149 missense possibly damaging 0.69
R7512:Olfr204 UTSW 16 59315027 missense probably damaging 0.99
R7702:Olfr204 UTSW 16 59314634 missense probably damaging 1.00
R8132:Olfr204 UTSW 16 59314544 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCAGGGCTCACATACATGAAG -3'
(R):5'- AACCCTCTGCTCTATCTAGTGG -3'

Sequencing Primer
(F):5'- CTCACATACATGAAGAGGAGGGTACC -3'
(R):5'- GTGATGTCCAAGAGACTCTGTAC -3'
Posted On2016-10-06