Incidental Mutation 'R5308:Olfr1195'
ID434458
Institutional Source Beutler Lab
Gene Symbol Olfr1195
Ensembl Gene ENSMUSG00000075121
Gene Nameolfactory receptor 1195
SynonymsMOR230-12_p, GA_x6K02T2Q125-50163514-50162588, MOR230-4
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5308 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88681455-88689187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88683405 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 109 (E109G)
Ref Sequence ENSEMBL: ENSMUSP00000149442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
Predicted Effect probably benign
Transcript: ENSMUST00000081697
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
AA Change: E109G

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121
AA Change: E109G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
AA Change: E109G

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213893
Predicted Effect probably benign
Transcript: ENSMUST00000216767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217271
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Olfr1195
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr1195 APN 2 88683294 missense probably benign
IGL01396:Olfr1195 APN 2 88683231 missense probably damaging 0.99
IGL02871:Olfr1195 APN 2 88683084 missense probably damaging 1.00
IGL03049:Olfr1195 APN 2 88683490 missense possibly damaging 0.49
R0408:Olfr1195 UTSW 2 88683655 missense probably benign 0.04
R1562:Olfr1195 UTSW 2 88683079 missense probably benign 0.01
R5806:Olfr1195 UTSW 2 88683151 missense probably damaging 1.00
R6119:Olfr1195 UTSW 2 88683591 missense probably damaging 0.98
R6178:Olfr1195 UTSW 2 88683633 missense probably damaging 1.00
R6510:Olfr1195 UTSW 2 88682958 missense probably benign 0.07
R6919:Olfr1195 UTSW 2 88683684 missense possibly damaging 0.93
R7205:Olfr1195 UTSW 2 88683423 missense possibly damaging 0.78
R7253:Olfr1195 UTSW 2 88683625 missense possibly damaging 0.87
R7663:Olfr1195 UTSW 2 88683352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTTTCAACAGTGGCTG -3'
(R):5'- TATTAAGACAAGCCCGGCCC -3'

Sequencing Primer
(F):5'- GTGATCAATCTCATTGGGACCACAG -3'
(R):5'- CCGGCCCTTGGGAGTCC -3'
Posted On2016-10-06