Incidental Mutation 'R8671:Olfr1195'
ID 661137
Institutional Source Beutler Lab
Gene Symbol Olfr1195
Ensembl Gene ENSMUSG00000075121
Gene Name olfactory receptor 1195
Synonyms MOR230-12_p, GA_x6K02T2Q125-50163514-50162588, MOR230-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R8671 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88681455-88689187 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88683105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 209 (F209Y)
Ref Sequence ENSEMBL: ENSMUSP00000149442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081697] [ENSMUST00000099818] [ENSMUST00000213545] [ENSMUST00000213893] [ENSMUST00000216767]
AlphaFold Q8VG21
Predicted Effect probably benign
Transcript: ENSMUST00000081697
SMART Domains Protein: ENSMUSP00000080399
Gene: ENSMUSG00000060827

DomainStartEndE-ValueType
Pfam:7tm_4 36 310 7.5e-51 PFAM
Pfam:7tm_1 46 292 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099818
AA Change: F209Y

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097406
Gene: ENSMUSG00000075121
AA Change: F209Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.6e-5 PFAM
Pfam:7tm_1 39 285 5.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213545
AA Change: F209Y

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000213893
Predicted Effect probably benign
Transcript: ENSMUST00000216767
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik C T 4: 73,942,929 E145K probably damaging Het
4930430A15Rik T C 2: 111,229,532 probably benign Het
4930467E23Rik T A 8: 19,734,759 L203* probably null Het
Ambp A T 4: 63,150,419 Y120* probably null Het
Ankrd36 C T 11: 5,629,312 A192V probably benign Het
Apol7e A T 15: 77,717,603 M134L probably benign Het
Atg9b A T 5: 24,386,109 N774K probably benign Het
BC027072 G T 17: 71,751,377 A435E probably benign Het
Catsperb T A 12: 101,594,337 N862K possibly damaging Het
Ccdc7a T A 8: 128,920,467 D648V probably damaging Het
Cfap54 G T 10: 92,955,072 P1855T unknown Het
Clcnkb T A 4: 141,412,230 T154S probably damaging Het
Cux1 C T 5: 136,250,600 R609H probably damaging Het
Eif2ak4 A G 2: 118,422,186 D413G possibly damaging Het
Flnc T C 6: 29,443,502 probably null Het
Grm5 T C 7: 88,116,290 probably null Het
Hectd3 T G 4: 116,996,581 F225V possibly damaging Het
Hpcal4 G T 4: 123,189,183 M107I probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ikbkap A G 4: 56,771,453 L948P probably damaging Het
Larp4 C A 15: 100,010,458 Q607K probably benign Het
March8 A G 6: 116,401,854 R250G probably benign Het
Med13 A C 11: 86,271,097 N2135K probably damaging Het
Msh5 T A 17: 35,045,933 R89* probably null Het
Musk T G 4: 58,286,051 probably benign Het
Myo18b T C 5: 112,874,743 Q261R unknown Het
Npr1 A T 3: 90,456,157 probably benign Het
Nynrin T A 14: 55,870,442 V1002E possibly damaging Het
Olfr1138 A T 2: 87,737,646 L226Q probably damaging Het
Olfr1315-ps1 T A 2: 112,110,988 K88M probably damaging Het
Olfr167 T C 16: 19,515,054 Y194C possibly damaging Het
Pcdh9 T C 14: 93,888,650 Y28C probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Prkd1 T A 12: 50,388,408 N512I probably benign Het
Pwwp2b C T 7: 139,256,410 P589L probably damaging Het
Rasgrp4 G A 7: 29,143,027 G242D probably damaging Het
Rcbtb1 T G 14: 59,230,524 V480G probably damaging Het
Rptn A G 3: 93,398,194 S945G probably benign Het
Slc22a2 C T 17: 12,605,976 Q242* probably null Het
Slfn3 T A 11: 83,212,999 V232E probably benign Het
Stab1 T A 14: 31,157,408 K705M probably damaging Het
Syn2 C A 6: 115,278,167 S480* probably null Het
Thsd4 A T 9: 60,394,445 L189H probably damaging Het
Tinagl1 T C 4: 130,167,804 T250A probably benign Het
Tnc A T 4: 64,017,446 C418S probably damaging Het
Ube2q1 A G 3: 89,776,078 E110G probably damaging Het
Wdfy4 G T 14: 32,971,765 probably benign Het
Xcl1 T C 1: 164,931,850 M94V probably benign Het
Zfp369 T C 13: 65,296,281 S413P possibly damaging Het
Zfp454 A C 11: 50,873,768 I279S possibly damaging Het
Zfp971 A C 2: 178,033,937 Q443P probably damaging Het
Other mutations in Olfr1195
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr1195 APN 2 88683294 missense probably benign
IGL01396:Olfr1195 APN 2 88683231 missense probably damaging 0.99
IGL02871:Olfr1195 APN 2 88683084 missense probably damaging 1.00
IGL03049:Olfr1195 APN 2 88683490 missense possibly damaging 0.49
R0408:Olfr1195 UTSW 2 88683655 missense probably benign 0.04
R1562:Olfr1195 UTSW 2 88683079 missense probably benign 0.01
R5308:Olfr1195 UTSW 2 88683405 missense probably benign 0.09
R5806:Olfr1195 UTSW 2 88683151 missense probably damaging 1.00
R6119:Olfr1195 UTSW 2 88683591 missense probably damaging 0.98
R6178:Olfr1195 UTSW 2 88683633 missense probably damaging 1.00
R6510:Olfr1195 UTSW 2 88682958 missense probably benign 0.07
R6919:Olfr1195 UTSW 2 88683684 missense possibly damaging 0.93
R7205:Olfr1195 UTSW 2 88683423 missense possibly damaging 0.78
R7253:Olfr1195 UTSW 2 88683625 missense possibly damaging 0.87
R7663:Olfr1195 UTSW 2 88683352 missense probably damaging 1.00
R8011:Olfr1195 UTSW 2 88683193 nonsense probably null
R8674:Olfr1195 UTSW 2 88683430 missense probably benign
R8845:Olfr1195 UTSW 2 88683391 missense possibly damaging 0.64
R9184:Olfr1195 UTSW 2 88683175 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGATATCATCTTGTCCATAGGGAAGG -3'
(R):5'- ATGAATCGCCAGGTCTGTGG -3'

Sequencing Primer
(F):5'- TCCATAGGGAAGGTGGTGGC -3'
(R):5'- GTGGGATCCTGTATACATTCATCAG -3'
Posted On 2021-03-08