Incidental Mutation 'R5538:Cybb'
ID434964
Institutional Source Beutler Lab
Gene Symbol Cybb
Ensembl Gene ENSMUSG00000015340
Gene Namecytochrome b-245, beta polypeptide
Synonymsgp91phox, gp91, Cgd, Nox2
MMRRC Submission 043096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5538 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location9435252-9487771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 9450750 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 246 (D246H)
Ref Sequence ENSEMBL: ENSMUSP00000015484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015484] [ENSMUST00000164685]
Predicted Effect probably benign
Transcript: ENSMUST00000015484
AA Change: D246H

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015484
Gene: ENSMUSG00000015340
AA Change: D246H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Ferric_reduct 54 220 8.4e-29 PFAM
Pfam:FAD_binding_6 292 395 1.6e-7 PFAM
Pfam:FAD_binding_8 292 395 1e-24 PFAM
Pfam:NAD_binding_6 401 551 5.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154503
Predicted Effect probably benign
Transcript: ENSMUST00000164685
SMART Domains Protein: ENSMUSP00000128963
Gene: ENSMUSG00000015340

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (73/78)
MGI Phenotype FUNCTION: This gene encodes the heavy chain component of a heterodimeric transmembrane ion transporter composed of both a heavy and a light chain. This transporter mediates the transfer of electrons from nicotinamide adenine dinucleotide phosphate (NADPH) to oxygen to generate superoxide. This reaction is important in the innate immune response to pathogens. However, increased activity of the encoded protein also leads to the generation of reactive oxygen species that result in oxidative stress and can cause tissue damage. Conversely, loss of function of the related gene in human causes chronic granulomatous disease. Alternative splicing results in multiple transcript variants, although the full-length nature of some of these variants has not been determined. [provided by RefSeq, May 2013]
PHENOTYPE: Nullizygous mice show alterations in acute inflammation, synaptic plasticity, memory, metastatic potential, susceptibility to infection and induced GI injury, inflammatory response to chemical peritonitis, vascular response to Ang II, hypoxia-induced LV remodeling, and L-NAME-caused renal responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900055J20Rik T A 18: 40,257,266 Y97* probably null Het
4930467E23Rik A C 8: 19,749,414 probably null Het
Adgrv1 C A 13: 81,433,689 R4745S probably benign Het
Ank3 A G 10: 69,987,427 E642G probably damaging Het
Arhgap11a G T 2: 113,837,530 D375E probably benign Het
Arl8b C A 6: 108,783,336 L28M probably damaging Het
Bbs2 G A 8: 94,089,763 T157M probably damaging Het
C2cd3 T A 7: 100,455,493 probably null Het
C6 T A 15: 4,814,829 I911N possibly damaging Het
Cc2d2a T C 5: 43,695,176 I365T possibly damaging Het
Cd46 T G 1: 195,068,170 probably null Het
Ceacam3 A T 7: 17,158,421 D363V probably damaging Het
Cep63 A T 9: 102,588,793 L678* probably null Het
Clasrp A C 7: 19,584,782 probably benign Het
Clk2 T A 3: 89,175,655 Y412N probably damaging Het
Col24a1 C T 3: 145,293,121 A5V probably damaging Het
Cox16 T C 12: 81,484,929 N13D possibly damaging Het
Dhx32 A T 7: 133,723,217 M437K probably benign Het
Dnm2 T C 9: 21,505,627 F819L probably benign Het
Dpysl4 A G 7: 139,091,990 T85A probably benign Het
Dspp A T 5: 104,175,230 K80* probably null Het
Dync2h1 T C 9: 7,168,630 probably benign Het
Ern1 A G 11: 106,421,901 V218A possibly damaging Het
Fbn2 G A 18: 58,071,901 R1157C probably benign Het
Fez1 T A 9: 36,868,876 I323N probably damaging Het
Fmo9 T A 1: 166,673,629 T199S probably benign Het
Fry T A 5: 150,495,848 L915Q probably damaging Het
Gm10719 T C 9: 3,018,962 L69S probably benign Het
Gnpda2 A T 5: 69,578,051 H230Q probably damaging Het
Gramd1c T A 16: 43,982,092 N652I probably damaging Het
H2-Bl T A 17: 36,081,286 H178L probably benign Het
Hells T A 19: 38,953,652 F462Y probably benign Het
Htr7 A G 19: 35,969,835 F260L probably benign Het
Itsn1 C A 16: 91,784,102 A23D probably damaging Het
Jak3 A G 8: 71,678,773 D94G probably benign Het
Kif20b A T 19: 34,952,964 K25* probably null Het
Klf2 T C 8: 72,319,472 L40P probably damaging Het
Kmt2a A G 9: 44,820,342 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lonrf1 T A 8: 36,223,024 probably null Het
Lrp1b A T 2: 40,697,474 I154K unknown Het
Mybpc1 T A 10: 88,546,029 I600L possibly damaging Het
Npnt T C 3: 132,904,963 N285S probably damaging Het
Olfr1255 T A 2: 89,816,620 F92Y probably damaging Het
Olfr429 T C 1: 174,089,978 *313R probably null Het
Olfr572 A G 7: 102,928,521 T298A probably damaging Het
Olfr816 T A 10: 129,912,002 Y92F probably benign Het
Pcnx T C 12: 81,860,409 V13A probably damaging Het
Pddc1 A G 7: 141,406,845 probably benign Het
Phkb G A 8: 85,922,127 V191I possibly damaging Het
Pnpla6 A G 8: 3,531,508 M594V probably benign Het
Prkdc A G 16: 15,651,469 E146G probably damaging Het
Ror1 T C 4: 100,441,011 M527T probably benign Het
Scnm1 A G 3: 95,129,755 probably benign Het
Skint11 A T 4: 114,231,762 N251I probably damaging Het
Slc19a3 T A 1: 83,022,561 N245I possibly damaging Het
Slc1a3 A T 15: 8,645,704 D272E probably damaging Het
Smok2b T A 17: 13,235,553 V200D possibly damaging Het
Sspo T C 6: 48,452,178 Y417H probably damaging Het
Stk11ip C A 1: 75,528,335 S388R probably damaging Het
Svep1 T C 4: 58,049,282 probably null Het
Sytl2 A G 7: 90,388,906 I525V probably benign Het
Tie1 T C 4: 118,486,193 N158D probably benign Het
Tle2 T C 10: 81,580,584 L180P probably damaging Het
Txlnb T C 10: 17,838,909 L363P probably damaging Het
Upk3b C G 5: 136,044,036 A258G probably benign Het
Usp32 A T 11: 85,017,786 D1031E possibly damaging Het
Vmn2r116 C T 17: 23,401,067 L592F probably benign Het
Zfp607b A G 7: 27,702,869 H250R probably damaging Het
Other mutations in Cybb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Cybb APN X 9446744 missense possibly damaging 0.46
IGL02145:Cybb APN X 9457018 missense probably damaging 1.00
IGL02626:Cybb APN X 9469200 splice site probably null
IGL02644:Cybb APN X 9467156 missense probably benign 0.00
IGL02869:Cybb APN X 9442589 missense probably benign 0.00
IGL03145:Cybb APN X 9453653 nonsense probably null
R3978:Cybb UTSW X 9444588 missense probably damaging 1.00
R3980:Cybb UTSW X 9444588 missense probably damaging 1.00
R4758:Cybb UTSW X 9450750 missense probably benign 0.10
R4761:Cybb UTSW X 9450750 missense probably benign 0.10
R4787:Cybb UTSW X 9450750 missense probably benign 0.10
R4788:Cybb UTSW X 9450750 missense probably benign 0.10
R4793:Cybb UTSW X 9450750 missense probably benign 0.10
R4847:Cybb UTSW X 9450750 missense probably benign 0.10
R4901:Cybb UTSW X 9450750 missense probably benign 0.10
R4902:Cybb UTSW X 9450750 missense probably benign 0.10
R4904:Cybb UTSW X 9450750 missense probably benign 0.10
R4914:Cybb UTSW X 9450750 missense probably benign 0.10
R4915:Cybb UTSW X 9450750 missense probably benign 0.10
R4916:Cybb UTSW X 9450750 missense probably benign 0.10
R5058:Cybb UTSW X 9450750 missense probably benign 0.10
R5246:Cybb UTSW X 9450750 missense probably benign 0.10
R5416:Cybb UTSW X 9450750 missense probably benign 0.10
R5519:Cybb UTSW X 9450750 missense probably benign 0.10
R5539:Cybb UTSW X 9450750 missense probably benign 0.10
R5576:Cybb UTSW X 9450750 missense probably benign 0.10
R5578:Cybb UTSW X 9450750 missense probably benign 0.10
R5728:Cybb UTSW X 9450750 missense probably benign 0.10
R5729:Cybb UTSW X 9450750 missense probably benign 0.10
R5761:Cybb UTSW X 9450750 missense probably benign 0.10
R5762:Cybb UTSW X 9450750 missense probably benign 0.10
R5927:Cybb UTSW X 9450750 missense probably benign 0.10
R6057:Cybb UTSW X 9450750 missense probably benign 0.10
R6086:Cybb UTSW X 9450750 missense probably benign 0.10
R6144:Cybb UTSW X 9450750 missense probably benign 0.10
R6147:Cybb UTSW X 9450750 missense probably benign 0.10
Z1176:Cybb UTSW X 9438240 missense probably damaging 0.99
Z1176:Cybb UTSW X 9440001 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCACATGTCCTGGTTTGG -3'
(R):5'- TTTGCGATATGTGCACAATCAG -3'

Sequencing Primer
(F):5'- CTTCTCAACTTGACACATGCTAGAG -3'
(R):5'- CACAATCAGTGTTGAGGATATAGGCC -3'
Posted On2016-10-24