Incidental Mutation 'R5548:2310057J18Rik'
ID434997
Institutional Source Beutler Lab
Gene Symbol 2310057J18Rik
Ensembl Gene ENSMUSG00000015519
Gene NameRIKEN cDNA 2310057J18 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location28972288-28986303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28973867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000121044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015663] [ENSMUST00000140558] [ENSMUST00000152363]
Predicted Effect probably benign
Transcript: ENSMUST00000015663
AA Change: D299G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000015663
Gene: ENSMUSG00000015519
AA Change: D299G

DomainStartEndE-ValueType
Pfam:DUF781 8 337 4.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140558
AA Change: D191G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121044
Gene: ENSMUSG00000015519
AA Change: D191G

DomainStartEndE-ValueType
Pfam:DUF781 1 228 5.1e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141350
Predicted Effect probably benign
Transcript: ENSMUST00000152363
AA Change: I237V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118049
Gene: ENSMUSG00000015519
AA Change: I237V

DomainStartEndE-ValueType
Pfam:DUF781 1 237 1.9e-116 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in 2310057J18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:2310057J18Rik APN 10 28973958 nonsense probably null
IGL01123:2310057J18Rik APN 10 28973938 missense probably damaging 1.00
IGL01989:2310057J18Rik APN 10 28986270 missense probably damaging 0.99
IGL02268:2310057J18Rik APN 10 28986246 missense probably benign 0.09
R0114:2310057J18Rik UTSW 10 28985982 splice site probably benign
R1585:2310057J18Rik UTSW 10 28982522 missense possibly damaging 0.95
R1642:2310057J18Rik UTSW 10 28986237 missense probably benign 0.44
R2271:2310057J18Rik UTSW 10 28981579 missense probably damaging 0.98
R4692:2310057J18Rik UTSW 10 28973886 nonsense probably null
R4801:2310057J18Rik UTSW 10 28983926 critical splice donor site probably null
R4802:2310057J18Rik UTSW 10 28983926 critical splice donor site probably null
R5677:2310057J18Rik UTSW 10 28986229 missense probably benign 0.00
R7260:2310057J18Rik UTSW 10 28973886 missense probably benign 0.07
R8024:2310057J18Rik UTSW 10 28982595 nonsense probably null
R8024:2310057J18Rik UTSW 10 28986217 missense possibly damaging 0.62
X0060:2310057J18Rik UTSW 10 28982510 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGCATTTAAATGAAGGGTCACATC -3'
(R):5'- GCTGTGAACTATTTAGCGGCAG -3'

Sequencing Primer
(F):5'- AAATGTGGTTGATCATTGGTTTTACC -3'
(R):5'- GCAGCCCGTCTTCCTACAAC -3'
Posted On2016-10-24