Incidental Mutation 'R5572:Pomk'
ID435737
Institutional Source Beutler Lab
Gene Symbol Pomk
Ensembl Gene ENSMUSG00000037251
Gene Nameprotein-O-mannose kinase
SynonymsSgk196, 4930444A02Rik
MMRRC Submission 043266-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R5572 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25980604-25994133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25983190 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 245 (H245L)
Ref Sequence ENSEMBL: ENSMUSP00000053802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061850
AA Change: H245L

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053802
Gene: ENSMUSG00000037251
AA Change: H245L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Pkinase 80 207 2e-6 PFAM
Pfam:Pkinase_Tyr 80 215 5.9e-11 PFAM
Meta Mutation Damage Score 0.2913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap insertion show hydrocephaly and cerebellar dysplasia. Mice also show learning defects, impaired motor strength and decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,264,567 D167V probably damaging Het
Abcb1a C T 5: 8,715,108 probably null Het
Abcd4 T C 12: 84,606,276 D380G probably benign Het
Actr3b T A 5: 25,809,888 D68E probably benign Het
Apol10a T C 15: 77,488,634 S157P probably damaging Het
Arap3 A T 18: 37,991,066 I327N probably damaging Het
Arnt G T 3: 95,474,704 V198L possibly damaging Het
Baiap3 T A 17: 25,251,475 D86V possibly damaging Het
Bcl9l G T 9: 44,500,798 R27L possibly damaging Het
C1qc T C 4: 136,892,462 Y34C probably benign Het
C1rb T C 6: 124,580,799 S632P probably benign Het
C3 A G 17: 57,224,673 S284P probably damaging Het
Cfap44 T G 16: 44,481,305 V1802G possibly damaging Het
Cfhr1 A G 1: 139,556,427 V117A possibly damaging Het
Clca3b T C 3: 144,827,309 D654G probably damaging Het
Col17a1 A T 19: 47,650,729 S1126T probably benign Het
Cts3 T A 13: 61,564,968 I313F probably damaging Het
Egfl7 T C 2: 26,591,691 V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 D272N probably damaging Het
Fam129a T C 1: 151,709,190 S513P probably benign Het
Foxp4 A G 17: 47,880,879 V111A unknown Het
Hmcn2 A T 2: 31,414,525 probably null Het
Hmcn2 G A 2: 31,414,526 probably null Het
Igsf11 C T 16: 39,024,932 R283C probably damaging Het
Il1a A G 2: 129,307,918 Y21H possibly damaging Het
Il6ra A T 3: 89,871,282 V420D probably damaging Het
Kdm5a T C 6: 120,412,375 V921A possibly damaging Het
Kirrel3 G A 9: 35,000,948 A196T probably damaging Het
Klra1 T A 6: 130,372,839 D212V possibly damaging Het
N4bp2l2 G A 5: 150,662,290 T75I probably benign Het
Nnmt A G 9: 48,592,147 L193P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ntm A G 9: 29,014,216 I191T probably damaging Het
Olfr318 A G 11: 58,720,229 V273A probably benign Het
Olfr607 A C 7: 103,460,698 L170R probably benign Het
Olfr652 A T 7: 104,564,994 T258S probably benign Het
Pam A C 1: 97,854,744 probably benign Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rasip1 G T 7: 45,636,729 R792L probably benign Het
Ret T C 6: 118,155,431 Y1016C probably damaging Het
Rhbdd1 A T 1: 82,340,810 N138I possibly damaging Het
Snx13 T G 12: 35,103,120 V383G probably damaging Het
Syt3 A G 7: 44,390,718 H125R probably benign Het
Tlr6 A T 5: 64,955,018 L182Q probably damaging Het
Tlr9 T C 9: 106,225,637 V709A possibly damaging Het
Tmprss6 T C 15: 78,442,422 Y655C probably damaging Het
Ttn A T 2: 76,853,628 probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Ube3b G A 5: 114,406,179 D546N probably damaging Het
Ugt2b36 A G 5: 87,089,482 V188A possibly damaging Het
Usp29 A G 7: 6,962,192 I345V probably benign Het
Vmn2r78 A G 7: 86,915,512 K55R probably benign Het
Wdsub1 A G 2: 59,862,707 F288L possibly damaging Het
Zan C T 5: 137,394,431 V4601M unknown Het
Zbtb8b T C 4: 129,428,541 K376E probably damaging Het
Zfp619 A T 7: 39,535,239 Y231F probably benign Het
Other mutations in Pomk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Pomk APN 8 25983596 missense probably benign 0.21
IGL02678:Pomk APN 8 25983107 missense probably damaging 0.97
IGL03090:Pomk APN 8 25983310 missense probably damaging 0.99
R1302:Pomk UTSW 8 25983074 missense probably damaging 1.00
R3105:Pomk UTSW 8 25982914 missense probably damaging 1.00
R4646:Pomk UTSW 8 25983605 missense probably damaging 1.00
R5106:Pomk UTSW 8 25986376 missense probably benign 0.00
R5343:Pomk UTSW 8 25983016 missense probably benign 0.09
R5953:Pomk UTSW 8 25983048 missense probably damaging 1.00
R6150:Pomk UTSW 8 25983256 missense possibly damaging 0.89
R6295:Pomk UTSW 8 25982927 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGCACGTTCTGAGCAGTG -3'
(R):5'- TTAACTATCTGCATCACAGCCC -3'

Sequencing Primer
(F):5'- CTTGCACGCCTTATGGATATCAAAC -3'
(R):5'- TGCATCACAGCCCCCTGG -3'
Posted On2016-10-24