Incidental Mutation 'R5572:Arap3'
ID435755
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
SynonymsDRAG1, E030006K04Rik, Centd3
MMRRC Submission 043266-MU
Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R5572 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37972624-37997574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37991066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 327 (I327N)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042944
AA Change: I327N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: I327N

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185063
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,264,567 D167V probably damaging Het
Abcb1a C T 5: 8,715,108 probably null Het
Abcd4 T C 12: 84,606,276 D380G probably benign Het
Actr3b T A 5: 25,809,888 D68E probably benign Het
Apol10a T C 15: 77,488,634 S157P probably damaging Het
Arnt G T 3: 95,474,704 V198L possibly damaging Het
Baiap3 T A 17: 25,251,475 D86V possibly damaging Het
Bcl9l G T 9: 44,500,798 R27L possibly damaging Het
C1qc T C 4: 136,892,462 Y34C probably benign Het
C1rb T C 6: 124,580,799 S632P probably benign Het
C3 A G 17: 57,224,673 S284P probably damaging Het
Cfap44 T G 16: 44,481,305 V1802G possibly damaging Het
Cfhr1 A G 1: 139,556,427 V117A possibly damaging Het
Clca3b T C 3: 144,827,309 D654G probably damaging Het
Col17a1 A T 19: 47,650,729 S1126T probably benign Het
Cts3 T A 13: 61,564,968 I313F probably damaging Het
Egfl7 T C 2: 26,591,691 V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 D272N probably damaging Het
Fam129a T C 1: 151,709,190 S513P probably benign Het
Foxp4 A G 17: 47,880,879 V111A unknown Het
Hmcn2 A T 2: 31,414,525 probably null Het
Hmcn2 G A 2: 31,414,526 probably null Het
Igsf11 C T 16: 39,024,932 R283C probably damaging Het
Il1a A G 2: 129,307,918 Y21H possibly damaging Het
Il6ra A T 3: 89,871,282 V420D probably damaging Het
Kdm5a T C 6: 120,412,375 V921A possibly damaging Het
Kirrel3 G A 9: 35,000,948 A196T probably damaging Het
Klra1 T A 6: 130,372,839 D212V possibly damaging Het
N4bp2l2 G A 5: 150,662,290 T75I probably benign Het
Nnmt A G 9: 48,592,147 L193P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ntm A G 9: 29,014,216 I191T probably damaging Het
Olfr318 A G 11: 58,720,229 V273A probably benign Het
Olfr607 A C 7: 103,460,698 L170R probably benign Het
Olfr652 A T 7: 104,564,994 T258S probably benign Het
Pam A C 1: 97,854,744 probably benign Het
Pomk T A 8: 25,983,190 H245L possibly damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rasip1 G T 7: 45,636,729 R792L probably benign Het
Ret T C 6: 118,155,431 Y1016C probably damaging Het
Rhbdd1 A T 1: 82,340,810 N138I possibly damaging Het
Snx13 T G 12: 35,103,120 V383G probably damaging Het
Syt3 A G 7: 44,390,718 H125R probably benign Het
Tlr6 A T 5: 64,955,018 L182Q probably damaging Het
Tlr9 T C 9: 106,225,637 V709A possibly damaging Het
Tmprss6 T C 15: 78,442,422 Y655C probably damaging Het
Ttn A T 2: 76,853,628 probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Ube3b G A 5: 114,406,179 D546N probably damaging Het
Ugt2b36 A G 5: 87,089,482 V188A possibly damaging Het
Usp29 A G 7: 6,962,192 I345V probably benign Het
Vmn2r78 A G 7: 86,915,512 K55R probably benign Het
Wdsub1 A G 2: 59,862,707 F288L possibly damaging Het
Zan C T 5: 137,394,431 V4601M unknown Het
Zbtb8b T C 4: 129,428,541 K376E probably damaging Het
Zfp619 A T 7: 39,535,239 Y231F probably benign Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 37975926 missense probably damaging 1.00
IGL01145:Arap3 APN 18 37989179 missense probably benign
IGL01154:Arap3 APN 18 37996734 missense probably benign 0.28
IGL01305:Arap3 APN 18 37991327 critical splice donor site probably null
IGL01542:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01543:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01544:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01545:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01677:Arap3 APN 18 37996647 missense probably benign
IGL01925:Arap3 APN 18 37984246 missense probably benign 0.21
IGL01933:Arap3 APN 18 37978453 missense possibly damaging 0.65
IGL02048:Arap3 APN 18 37996979 missense possibly damaging 0.56
IGL02064:Arap3 APN 18 37991701 missense probably damaging 1.00
IGL02207:Arap3 APN 18 37987853 missense probably benign 0.00
IGL02376:Arap3 APN 18 37978453 missense possibly damaging 0.95
IGL02531:Arap3 APN 18 37989751 missense probably damaging 0.99
IGL02568:Arap3 APN 18 37996658 missense probably benign 0.32
IGL02640:Arap3 APN 18 37987802 missense possibly damaging 0.71
IGL02658:Arap3 APN 18 37990994 missense probably benign 0.09
IGL03090:Arap3 APN 18 37989112 missense probably benign 0.00
IGL03352:Arap3 APN 18 37981302 splice site probably benign
ANU22:Arap3 UTSW 18 37991327 critical splice donor site probably null
P0016:Arap3 UTSW 18 37984348 missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 37996895 missense probably benign 0.08
R0066:Arap3 UTSW 18 37996707 missense probably benign 0.01
R0324:Arap3 UTSW 18 37973225 missense possibly damaging 0.93
R0562:Arap3 UTSW 18 37975540 missense probably damaging 1.00
R1289:Arap3 UTSW 18 37981973 missense possibly damaging 0.95
R1346:Arap3 UTSW 18 37975918 missense probably damaging 1.00
R1419:Arap3 UTSW 18 37978432 missense possibly damaging 0.51
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1537:Arap3 UTSW 18 37989684 critical splice donor site probably null
R1644:Arap3 UTSW 18 37984245 missense probably damaging 1.00
R1731:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1758:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1843:Arap3 UTSW 18 37975583 missense probably damaging 1.00
R1907:Arap3 UTSW 18 37996671 missense probably benign 0.28
R1954:Arap3 UTSW 18 37982002 missense probably damaging 1.00
R2124:Arap3 UTSW 18 37973350 missense probably damaging 0.98
R2135:Arap3 UTSW 18 37974456 missense probably damaging 1.00
R2172:Arap3 UTSW 18 37990560 missense probably damaging 1.00
R2418:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2419:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2907:Arap3 UTSW 18 37990527 missense possibly damaging 0.88
R4425:Arap3 UTSW 18 37978600 missense probably damaging 1.00
R4669:Arap3 UTSW 18 37996254 missense probably benign 0.08
R4734:Arap3 UTSW 18 37996275 missense probably benign 0.00
R4815:Arap3 UTSW 18 37973243 missense probably benign
R5328:Arap3 UTSW 18 37991687 missense possibly damaging 0.92
R5350:Arap3 UTSW 18 37982035 missense probably damaging 1.00
R5466:Arap3 UTSW 18 37996736 missense probably benign 0.00
R5482:Arap3 UTSW 18 37974674 missense possibly damaging 0.95
R5779:Arap3 UTSW 18 37984365 missense probably damaging 1.00
R6053:Arap3 UTSW 18 37990771 missense probably damaging 0.98
R6144:Arap3 UTSW 18 37985433 missense probably damaging 0.98
R6166:Arap3 UTSW 18 37974370 missense probably damaging 1.00
R6248:Arap3 UTSW 18 37991354 missense probably benign 0.09
R6266:Arap3 UTSW 18 37990791 missense probably damaging 0.98
R6385:Arap3 UTSW 18 37997031 nonsense probably null
R6694:Arap3 UTSW 18 37991537 critical splice donor site probably null
R6856:Arap3 UTSW 18 37979863 missense possibly damaging 0.95
R7073:Arap3 UTSW 18 37974442 nonsense probably null
R7297:Arap3 UTSW 18 37973563 missense possibly damaging 0.81
R7352:Arap3 UTSW 18 37973278 missense probably benign 0.00
R7652:Arap3 UTSW 18 37978452 missense probably damaging 0.99
R7726:Arap3 UTSW 18 37989467 missense probably damaging 0.99
R7747:Arap3 UTSW 18 37988888 splice site probably null
R7944:Arap3 UTSW 18 37989179 missense probably benign
R8152:Arap3 UTSW 18 37991357 missense possibly damaging 0.61
R8338:Arap3 UTSW 18 37973630 missense probably damaging 0.99
R8549:Arap3 UTSW 18 37973312 missense probably benign 0.17
X0011:Arap3 UTSW 18 37974101 critical splice donor site probably null
X0026:Arap3 UTSW 18 37985311 critical splice donor site probably null
X0027:Arap3 UTSW 18 37973485 splice site probably null
X0066:Arap3 UTSW 18 37991646 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCCTTCAGGCAGGATTG -3'
(R):5'- CCCATGGTAGAAGGATGACCAC -3'

Sequencing Primer
(F):5'- AGCACCATAGGTCACGCTGAG -3'
(R):5'- GGATGACCACAGCTTCCAGATG -3'
Posted On2016-10-24