Mutagenetix > Incidental Mutations

Incidental Mutation 'R5572:Arap3'

435755

Institutional Source

Beutler Lab

Gene Symbol

Arap3

Ensembl Gene

ENSMUSG00000024451

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3

Synonyms

DRAG1, E030006K04Rik, Centd3

MMRRC Submission

043266-MU

Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene?

Possibly essential (E-score: 0.748) question?

Stock #

R5572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37972624-37997574 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37991066 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 327 (I327N)

Ref Sequence

ENSEMBL: ENSMUSP00000035662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042944]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042944
AA Change: I327N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: I327N

Domain	Start	End	E-Value	Type
SAM	1	68	1.5e-7	SMART
low complexity region	81	98	N/A	INTRINSIC
low complexity region	134	142	N/A	INTRINSIC
PH	283	376	3.4e-16	SMART
PH	390	480	1.61e-8	SMART
ArfGap	484	606	1.44e-25	SMART
low complexity region	642	661	N/A	INTRINSIC
PH	671	785	2.86e1	SMART
PH	795	901	6.87e-3	SMART
RhoGAP	913	1089	2.11e-47	SMART
Pfam:RA	1113	1206	6.2e-16	PFAM
PH	1220	1323	3.46e-8	SMART
low complexity region	1388	1407	N/A	INTRINSIC
low complexity region	1457	1469	N/A	INTRINSIC
low complexity region	1475	1486	N/A	INTRINSIC
low complexity region	1494	1529	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185063

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,264,567	D167V	probably damaging	Het
Abcb1a	C	T	5: 8,715,108		probably null	Het
Abcd4	T	C	12: 84,606,276	D380G	probably benign	Het
Actr3b	T	A	5: 25,809,888	D68E	probably benign	Het
Apol10a	T	C	15: 77,488,634	S157P	probably damaging	Het
Arnt	G	T	3: 95,474,704	V198L	possibly damaging	Het
Baiap3	T	A	17: 25,251,475	D86V	possibly damaging	Het
Bcl9l	G	T	9: 44,500,798	R27L	possibly damaging	Het
C1qc	T	C	4: 136,892,462	Y34C	probably benign	Het
C1rb	T	C	6: 124,580,799	S632P	probably benign	Het
C3	A	G	17: 57,224,673	S284P	probably damaging	Het
Cfap44	T	G	16: 44,481,305	V1802G	possibly damaging	Het
Cfhr1	A	G	1: 139,556,427	V117A	possibly damaging	Het
Clca3b	T	C	3: 144,827,309	D654G	probably damaging	Het
Col17a1	A	T	19: 47,650,729	S1126T	probably benign	Het
Cts3	T	A	13: 61,564,968	I313F	probably damaging	Het
Egfl7	T	C	2: 26,591,691	V6A	possibly damaging	Het
Eif2s3y	G	A	Y: 1,016,631	D272N	probably damaging	Het
Fam129a	T	C	1: 151,709,190	S513P	probably benign	Het
Foxp4	A	G	17: 47,880,879	V111A	unknown	Het
Hmcn2	A	T	2: 31,414,525		probably null	Het
Hmcn2	G	A	2: 31,414,526		probably null	Het
Igsf11	C	T	16: 39,024,932	R283C	probably damaging	Het
Il1a	A	G	2: 129,307,918	Y21H	possibly damaging	Het
Il6ra	A	T	3: 89,871,282	V420D	probably damaging	Het
Kdm5a	T	C	6: 120,412,375	V921A	possibly damaging	Het
Kirrel3	G	A	9: 35,000,948	A196T	probably damaging	Het
Klra1	T	A	6: 130,372,839	D212V	possibly damaging	Het
N4bp2l2	G	A	5: 150,662,290	T75I	probably benign	Het
Nnmt	A	G	9: 48,592,147	L193P	probably damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Ntm	A	G	9: 29,014,216	I191T	probably damaging	Het
Olfr318	A	G	11: 58,720,229	V273A	probably benign	Het
Olfr607	A	C	7: 103,460,698	L170R	probably benign	Het
Olfr652	A	T	7: 104,564,994	T258S	probably benign	Het
Pam	A	C	1: 97,854,744		probably benign	Het
Pomk	T	A	8: 25,983,190	H245L	possibly damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rasip1	G	T	7: 45,636,729	R792L	probably benign	Het
Ret	T	C	6: 118,155,431	Y1016C	probably damaging	Het
Rhbdd1	A	T	1: 82,340,810	N138I	possibly damaging	Het
Snx13	T	G	12: 35,103,120	V383G	probably damaging	Het
Syt3	A	G	7: 44,390,718	H125R	probably benign	Het
Tlr6	A	T	5: 64,955,018	L182Q	probably damaging	Het
Tlr9	T	C	9: 106,225,637	V709A	possibly damaging	Het
Tmprss6	T	C	15: 78,442,422	Y655C	probably damaging	Het
Ttn	A	T	2: 76,853,628		probably benign	Het
Ube3a	T	C	7: 59,288,777	I761T	probably damaging	Het
Ube3b	G	A	5: 114,406,179	D546N	probably damaging	Het
Ugt2b36	A	G	5: 87,089,482	V188A	possibly damaging	Het
Usp29	A	G	7: 6,962,192	I345V	probably benign	Het
Vmn2r78	A	G	7: 86,915,512	K55R	probably benign	Het
Wdsub1	A	G	2: 59,862,707	F288L	possibly damaging	Het
Zan	C	T	5: 137,394,431	V4601M	unknown	Het
Zbtb8b	T	C	4: 129,428,541	K376E	probably damaging	Het
Zfp619	A	T	7: 39,535,239	Y231F	probably benign	Het

Other mutations in Arap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Arap3	APN	18	37975926	missense	probably damaging	1.00
IGL01145:Arap3	APN	18	37989179	missense	probably benign
IGL01154:Arap3	APN	18	37996734	missense	probably benign	0.28
IGL01305:Arap3	APN	18	37991327	critical splice donor site	probably null
IGL01542:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01543:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01544:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01545:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01677:Arap3	APN	18	37996647	missense	probably benign
IGL01925:Arap3	APN	18	37984246	missense	probably benign	0.21
IGL01933:Arap3	APN	18	37978453	missense	possibly damaging	0.65
IGL02048:Arap3	APN	18	37996979	missense	possibly damaging	0.56
IGL02064:Arap3	APN	18	37991701	missense	probably damaging	1.00
IGL02207:Arap3	APN	18	37987853	missense	probably benign	0.00
IGL02376:Arap3	APN	18	37978453	missense	possibly damaging	0.95
IGL02531:Arap3	APN	18	37989751	missense	probably damaging	0.99
IGL02568:Arap3	APN	18	37996658	missense	probably benign	0.32
IGL02640:Arap3	APN	18	37987802	missense	possibly damaging	0.71
IGL02658:Arap3	APN	18	37990994	missense	probably benign	0.09
IGL03090:Arap3	APN	18	37989112	missense	probably benign	0.00
IGL03352:Arap3	APN	18	37981302	splice site	probably benign
ANU22:Arap3	UTSW	18	37991327	critical splice donor site	probably null
P0016:Arap3	UTSW	18	37984348	missense	probably benign	0.00
PIT4260001:Arap3	UTSW	18	37996895	missense	probably benign	0.08
R0066:Arap3	UTSW	18	37996707	missense	probably benign	0.01
R0324:Arap3	UTSW	18	37973225	missense	possibly damaging	0.93
R0562:Arap3	UTSW	18	37975540	missense	probably damaging	1.00
R1289:Arap3	UTSW	18	37981973	missense	possibly damaging	0.95
R1346:Arap3	UTSW	18	37975918	missense	probably damaging	1.00
R1419:Arap3	UTSW	18	37978432	missense	possibly damaging	0.51
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1537:Arap3	UTSW	18	37989684	critical splice donor site	probably null
R1644:Arap3	UTSW	18	37984245	missense	probably damaging	1.00
R1731:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1758:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1843:Arap3	UTSW	18	37975583	missense	probably damaging	1.00
R1907:Arap3	UTSW	18	37996671	missense	probably benign	0.28
R1954:Arap3	UTSW	18	37982002	missense	probably damaging	1.00
R2124:Arap3	UTSW	18	37973350	missense	probably damaging	0.98
R2135:Arap3	UTSW	18	37974456	missense	probably damaging	1.00
R2172:Arap3	UTSW	18	37990560	missense	probably damaging	1.00
R2418:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2419:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2907:Arap3	UTSW	18	37990527	missense	possibly damaging	0.88
R4425:Arap3	UTSW	18	37978600	missense	probably damaging	1.00
R4669:Arap3	UTSW	18	37996254	missense	probably benign	0.08
R4734:Arap3	UTSW	18	37996275	missense	probably benign	0.00
R4815:Arap3	UTSW	18	37973243	missense	probably benign
R5328:Arap3	UTSW	18	37991687	missense	possibly damaging	0.92
R5350:Arap3	UTSW	18	37982035	missense	probably damaging	1.00
R5466:Arap3	UTSW	18	37996736	missense	probably benign	0.00
R5482:Arap3	UTSW	18	37974674	missense	possibly damaging	0.95
R5779:Arap3	UTSW	18	37984365	missense	probably damaging	1.00
R6053:Arap3	UTSW	18	37990771	missense	probably damaging	0.98
R6144:Arap3	UTSW	18	37985433	missense	probably damaging	0.98
R6166:Arap3	UTSW	18	37974370	missense	probably damaging	1.00
R6248:Arap3	UTSW	18	37991354	missense	probably benign	0.09
R6266:Arap3	UTSW	18	37990791	missense	probably damaging	0.98
R6385:Arap3	UTSW	18	37997031	nonsense	probably null
R6694:Arap3	UTSW	18	37991537	critical splice donor site	probably null
R6856:Arap3	UTSW	18	37979863	missense	possibly damaging	0.95
R7073:Arap3	UTSW	18	37974442	nonsense	probably null
R7297:Arap3	UTSW	18	37973563	missense	possibly damaging	0.81
R7352:Arap3	UTSW	18	37973278	missense	probably benign	0.00
R7652:Arap3	UTSW	18	37978452	missense	probably damaging	0.99
R7726:Arap3	UTSW	18	37989467	missense	probably damaging	0.99
R7747:Arap3	UTSW	18	37988888	splice site	probably null
R7944:Arap3	UTSW	18	37989179	missense	probably benign
R8152:Arap3	UTSW	18	37991357	missense	possibly damaging	0.61
R8338:Arap3	UTSW	18	37973630	missense	probably damaging	0.99
R8549:Arap3	UTSW	18	37973312	missense	probably benign	0.17
X0011:Arap3	UTSW	18	37974101	critical splice donor site	probably null
X0026:Arap3	UTSW	18	37985311	critical splice donor site	probably null
X0027:Arap3	UTSW	18	37973485	splice site	probably null
X0066:Arap3	UTSW	18	37991646	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTTCCTTCAGGCAGGATTG -3'
(R):5'- CCCATGGTAGAAGGATGACCAC -3'

Sequencing Primer
(F):5'- AGCACCATAGGTCACGCTGAG -3'
(R):5'- GGATGACCACAGCTTCCAGATG -3'

Posted On

2016-10-24