Incidental Mutation 'R5608:Serpina5'
ID439403
Institutional Source Beutler Lab
Gene Symbol Serpina5
Ensembl Gene ENSMUSG00000041550
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 5
Synonymsalpha-1 antiproteinase, Pci, PAI-3, antitrypsin
MMRRC Submission 043272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5608 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104101113-104106137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104103744 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 300 (Y300S)
Ref Sequence ENSEMBL: ENSMUSP00000021495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021495]
Predicted Effect probably damaging
Transcript: ENSMUST00000021495
AA Change: Y300S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021495
Gene: ENSMUSG00000041550
AA Change: Y300S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 48 405 1.4e-160 SMART
Meta Mutation Damage Score 0.2088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. This family member is a glycoprotein that can inhibit several serine proteases, including protein C and various plasminogen activators and kallikreins, and it thus plays diverse roles in hemostasis and thrombosis in multiple organs. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal with the exception that males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,048 Q1017R probably damaging Het
Adamtsl5 T C 10: 80,342,947 D199G probably benign Het
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Adgrv1 T C 13: 81,155,276 E117G probably damaging Het
Alkbh7 A T 17: 56,998,446 I88F probably damaging Het
Ankrd26 C A 6: 118,511,622 D1359Y probably damaging Het
Apoo-ps T C 13: 107,414,209 noncoding transcript Het
Arfgap2 G A 2: 91,270,202 R298H probably damaging Het
Birc6 G A 17: 74,613,544 V2109I probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Bpifa1 T C 2: 154,147,575 probably benign Het
Capn7 A G 14: 31,370,707 Y737C probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Colec12 T A 18: 9,848,267 D148E possibly damaging Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Dpysl4 T C 7: 139,098,543 V473A probably damaging Het
Dyrk3 T C 1: 131,128,715 S574G probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Helq C T 5: 100,790,219 G454S probably damaging Het
Incenp CGCTGCTGCTGC CGCTGCTGCTGCTGC 19: 9,893,868 probably benign Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Ltbp2 A C 12: 84,787,464 probably null Het
Marcks A T 10: 37,136,916 V41E probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Nhlrc3 C T 3: 53,462,311 probably null Het
Olfr145 G A 9: 37,897,782 C126Y probably damaging Het
Olfr353 A G 2: 36,890,515 F111S probably damaging Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Olfr617 G A 7: 103,584,299 W92* probably null Het
Pcdhga6 A G 18: 37,707,461 N78S possibly damaging Het
Plag1 T A 4: 3,905,463 K76* probably null Het
Ptpn21 T A 12: 98,688,777 T644S probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Rnf157 A T 11: 116,396,320 probably null Het
Slc41a3 A G 6: 90,640,907 K279R probably benign Het
Smndc1 A G 19: 53,383,653 V110A probably benign Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Utrn A T 10: 12,671,837 S1620T probably benign Het
Xkr4 T C 1: 3,671,380 probably benign Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Serpina5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Serpina5 APN 12 104105220 missense probably damaging 1.00
IGL01138:Serpina5 APN 12 104103744 missense possibly damaging 0.60
IGL01526:Serpina5 APN 12 104101890 missense probably damaging 1.00
IGL02159:Serpina5 APN 12 104105298 missense possibly damaging 0.95
IGL02351:Serpina5 APN 12 104102125 missense probably damaging 1.00
IGL02358:Serpina5 APN 12 104102125 missense probably damaging 1.00
IGL02735:Serpina5 APN 12 104103857 missense probably benign 0.21
IGL03087:Serpina5 APN 12 104101733 missense probably benign 0.01
R0189:Serpina5 UTSW 12 104103330 missense probably damaging 1.00
R0304:Serpina5 UTSW 12 104103200 missense possibly damaging 0.76
R0492:Serpina5 UTSW 12 104102133 missense probably damaging 1.00
R0511:Serpina5 UTSW 12 104103362 missense probably benign 0.00
R0611:Serpina5 UTSW 12 104103787 missense probably benign
R1016:Serpina5 UTSW 12 104105323 missense probably damaging 0.97
R1649:Serpina5 UTSW 12 104105225 missense possibly damaging 0.94
R1970:Serpina5 UTSW 12 104103857 missense probably benign 0.02
R4429:Serpina5 UTSW 12 104103406 missense probably benign 0.00
R4805:Serpina5 UTSW 12 104102201 missense probably damaging 0.97
R6226:Serpina5 UTSW 12 104101778 missense possibly damaging 0.72
R7097:Serpina5 UTSW 12 104102295 critical splice donor site probably null
R7357:Serpina5 UTSW 12 104103380 missense possibly damaging 0.85
R8208:Serpina5 UTSW 12 104105273 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCCAAACTTAAATGTTACCCATC -3'
(R):5'- TTTCTGAAATCAGGTGCTCAGG -3'

Sequencing Primer
(F):5'- TCAAGTCTTCAGTCCAGGACATG -3'
(R):5'- GGAGCTTCTAGACTCACCTCAG -3'
Posted On2016-10-26