Incidental Mutation 'R5608:Olfr617'
ID 439388
Institutional Source Beutler Lab
Gene Symbol Olfr617
Ensembl Gene ENSMUSG00000073946
Gene Name olfactory receptor 617
Synonyms GA_x6K02T2PBJ9-6306819-6307775, MOR31-10
MMRRC Submission 043272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5608 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103573061-103586795 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 103584299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 92 (W92*)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
AlphaFold Q8VGA1
Predicted Effect probably null
Transcript: ENSMUST00000048265
AA Change: W92*
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: W92*

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179692
Predicted Effect probably null
Transcript: ENSMUST00000215755
AA Change: W92*
Predicted Effect probably null
Transcript: ENSMUST00000216516
AA Change: W92*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,048 Q1017R probably damaging Het
Adamtsl5 T C 10: 80,342,947 D199G probably benign Het
Adgrl1 G T 8: 83,937,257 G1118W probably damaging Het
Adgrv1 T C 13: 81,155,276 E117G probably damaging Het
Alkbh7 A T 17: 56,998,446 I88F probably damaging Het
Ankrd26 C A 6: 118,511,622 D1359Y probably damaging Het
Apoo-ps T C 13: 107,414,209 noncoding transcript Het
Arfgap2 G A 2: 91,270,202 R298H probably damaging Het
Birc6 G A 17: 74,613,544 V2109I probably damaging Het
Blvrb C T 7: 27,459,469 P98L probably benign Het
Bmpr1b C A 3: 141,857,522 M220I possibly damaging Het
Bpifa1 T C 2: 154,147,575 probably benign Het
Capn7 A G 14: 31,370,707 Y737C probably damaging Het
Cdh13 A T 8: 118,757,474 D158V probably benign Het
Cenpe C A 3: 135,235,076 S662* probably null Het
Colec12 T A 18: 9,848,267 D148E possibly damaging Het
Dennd5a C A 7: 109,919,423 E480* probably null Het
Dpysl4 T C 7: 139,098,543 V473A probably damaging Het
Dyrk3 T C 1: 131,128,715 S574G probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
H2-Aa T C 17: 34,283,842 T117A possibly damaging Het
Helq C T 5: 100,790,219 G454S probably damaging Het
Incenp CGCTGCTGCTGC CGCTGCTGCTGCTGC 19: 9,893,868 probably benign Het
Ktn1 TTGTTGTCTTTGTGTT TTGTT 14: 47,734,097 probably benign Het
Lig1 C A 7: 13,306,008 T715N probably damaging Het
Lrrc31 C A 3: 30,689,845 probably null Het
Ltbp2 A C 12: 84,787,464 probably null Het
Marcks A T 10: 37,136,916 V41E probably damaging Het
Mex3c T A 18: 73,589,943 M369K possibly damaging Het
Msh6 A G 17: 87,986,901 D1028G probably damaging Het
Nhlrc3 C T 3: 53,462,311 probably null Het
Olfr145 G A 9: 37,897,782 C126Y probably damaging Het
Olfr353 A G 2: 36,890,515 F111S probably damaging Het
Olfr591 T C 7: 103,172,849 T263A probably damaging Het
Pcdhga6 A G 18: 37,707,461 N78S possibly damaging Het
Plag1 T A 4: 3,905,463 K76* probably null Het
Ptpn21 T A 12: 98,688,777 T644S probably benign Het
Qrfpr A G 3: 36,180,965 V292A possibly damaging Het
Rbbp6 T A 7: 122,997,086 V617E probably damaging Het
Rnf157 A T 11: 116,396,320 probably null Het
Serpina5 A C 12: 104,103,744 Y300S probably damaging Het
Slc41a3 A G 6: 90,640,907 K279R probably benign Het
Smndc1 A G 19: 53,383,653 V110A probably benign Het
Tubgcp6 A G 15: 89,111,150 V419A probably benign Het
Uggt2 C T 14: 119,089,199 G200D possibly damaging Het
Utrn A T 10: 12,671,837 S1620T probably benign Het
Xkr4 T C 1: 3,671,380 probably benign Het
Zscan22 G A 7: 12,906,992 G388S probably damaging Het
Other mutations in Olfr617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr617 APN 7 103584693 missense probably damaging 1.00
IGL01355:Olfr617 APN 7 103584373 missense probably damaging 1.00
IGL01411:Olfr617 APN 7 103584117 missense probably damaging 1.00
IGL01412:Olfr617 APN 7 103584907 missense probably damaging 1.00
IGL02379:Olfr617 APN 7 103584892 missense possibly damaging 0.84
ANU23:Olfr617 UTSW 7 103584693 missense probably damaging 1.00
IGL03054:Olfr617 UTSW 7 103584840 missense probably benign 0.23
R0536:Olfr617 UTSW 7 103584261 missense probably damaging 1.00
R4222:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R4224:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R5342:Olfr617 UTSW 7 103584828 missense probably benign 0.05
R5587:Olfr617 UTSW 7 103584531 missense probably benign 0.07
R5607:Olfr617 UTSW 7 103584299 nonsense probably null
R6904:Olfr617 UTSW 7 103584520 missense possibly damaging 0.83
R6929:Olfr617 UTSW 7 103584444 missense probably damaging 0.98
R7399:Olfr617 UTSW 7 103584381 missense possibly damaging 0.78
R7607:Olfr617 UTSW 7 103584930 missense probably damaging 0.97
R7771:Olfr617 UTSW 7 103584090 missense probably benign 0.33
Z1177:Olfr617 UTSW 7 103584699 missense probably benign 0.41
Z1177:Olfr617 UTSW 7 103584947 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGATCCCAGGACTAGAATATGC -3'
(R):5'- CAGCTGCAATGCCCATTTTG -3'

Sequencing Primer
(F):5'- GAATATGCACACATATGGATCTCC -3'
(R):5'- CTGCAATGCCCATTTTGATGATGAC -3'
Posted On 2016-10-26