Incidental Mutation 'R5754:Gtf3c1'
ID444953
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125644065 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1789 (V1789D)
Ref Sequence ENSEMBL: ENSMUSP00000145939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205659] [ENSMUST00000206183]
Predicted Effect probably benign
Transcript: ENSMUST00000055506
AA Change: V1885D

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: V1885D

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205659
AA Change: V1789D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206042
Predicted Effect probably benign
Transcript: ENSMUST00000206183
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nrap T C 19: 56,389,484 T25A possibly damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 intron probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0658:Gtf3c1 UTSW 7 125698962 missense probably damaging 1.00
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1481:Gtf3c1 UTSW 7 125693138 critical splice donor site probably null
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R2697:Gtf3c1 UTSW 7 125643954 missense probably damaging 0.98
R3963:Gtf3c1 UTSW 7 125693225 unclassified probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4653:Gtf3c1 UTSW 7 125674100 missense probably benign 0.23
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6223:Gtf3c1 UTSW 7 125676625 missense probably benign 0.01
R6580:Gtf3c1 UTSW 7 125644347 missense probably benign 0.02
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense probably damaging 0.98
R7555:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAAGCTGGAACTCACAG -3'
(R):5'- CCTGGCTTCTGCATTCAATG -3'

Sequencing Primer
(F):5'- GCTGGAACTCACAGCCCAG -3'
(R):5'- CATTCAATGCGTCTGAGAGAC -3'
Posted On2016-11-21