Incidental Mutation 'R1481:Gtf3c1'
ID164373
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1481 (G1)
Quality Score215
Status Validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 125693138 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205444] [ENSMUST00000205659] [ENSMUST00000206127]
Predicted Effect probably null
Transcript: ENSMUST00000055506
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205347
Predicted Effect probably benign
Transcript: ENSMUST00000205444
Predicted Effect probably null
Transcript: ENSMUST00000205659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205697
Predicted Effect probably benign
Transcript: ENSMUST00000206127
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 intron probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0658:Gtf3c1 UTSW 7 125698962 missense probably damaging 1.00
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R2697:Gtf3c1 UTSW 7 125643954 missense probably damaging 0.98
R3963:Gtf3c1 UTSW 7 125693225 unclassified probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4653:Gtf3c1 UTSW 7 125674100 missense probably benign 0.23
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5754:Gtf3c1 UTSW 7 125644065 missense possibly damaging 0.86
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6223:Gtf3c1 UTSW 7 125676625 missense probably benign 0.01
R6580:Gtf3c1 UTSW 7 125644347 missense probably benign 0.02
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense probably damaging 0.98
R7555:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCCATCTCTGAAACACACTC -3'
(R):5'- CCCAGTGCCTTAACTTAGCAGTACC -3'

Sequencing Primer
(F):5'- gcagtagagcccttgacc -3'
(R):5'- AGTACATGCTGAATGCTGGG -3'
Posted On2014-03-28