Mutagenetix > Incidental Mutations

Incidental Mutation 'R0658:Gtf3c1'

218806

Institutional Source

Beutler Lab

Gene Symbol

Gtf3c1

Ensembl Gene

ENSMUSG00000032777

Gene Name

general transcription factor III C 1

Synonyms

MMRRC Submission

038843-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0658 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

125640954-125707780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125698962 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 146 (F146L)

Ref Sequence

ENSEMBL: ENSMUSP00000145607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205444] [ENSMUST00000205659] [ENSMUST00000206127]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055506
AA Change: F247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: F247L

Domain	Start	End	E-Value	Type
Pfam:B-block_TFIIIC	174	250	5.1e-20	PFAM
low complexity region	344	354	N/A	INTRINSIC
low complexity region	474	514	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	592	604	N/A	INTRINSIC
low complexity region	725	745	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	1158	1173	N/A	INTRINSIC
low complexity region	1359	1372	N/A	INTRINSIC
low complexity region	1423	1443	N/A	INTRINSIC
low complexity region	1585	1620	N/A	INTRINSIC
low complexity region	1895	1915	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205347

Predicted Effect

probably damaging
Transcript: ENSMUST00000205444
AA Change: F247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000205659
AA Change: F247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205697

Predicted Effect

probably damaging
Transcript: ENSMUST00000206127
AA Change: F146L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7661

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

99% (78/79)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	C	T	5: 100,817,961		probably null	Het
Acsl3	A	G	1: 78,701,287	D520G	probably damaging	Het
Adgrl3	T	C	5: 81,648,713	V623A	probably benign	Het
Ak9	G	T	10: 41,347,222	V454L	probably damaging	Het
Alpk2	C	A	18: 65,349,487	K483N	probably damaging	Het
Arhgef12	T	C	9: 42,981,985	Y974C	probably damaging	Het
Armc8	C	T	9: 99,536,158		probably benign	Het
Atp2a2	C	T	5: 122,457,633		probably benign	Het
Atrn	T	C	2: 130,970,227		probably null	Het
Caps2	T	A	10: 112,204,038		probably benign	Het
Cep76	A	G	18: 67,623,304	S486P	probably damaging	Het
Cep97	C	T	16: 55,914,902	R583H	probably benign	Het
Cog7	A	G	7: 121,956,140		probably benign	Het
Commd5	T	A	15: 76,900,568	V55E	probably damaging	Het
Csmd3	A	T	15: 48,011,147	D684E	possibly damaging	Het
Ctxn2	T	C	2: 125,147,456	M1T	probably null	Het
Exph5	A	G	9: 53,377,475	D1952G	unknown	Het
Fmo2	A	T	1: 162,876,774	L521Q	possibly damaging	Het
Fryl	T	A	5: 73,065,359	T1960S	probably damaging	Het
G6pd2	T	C	5: 61,809,674	L264P	probably damaging	Het
Gm1966	C	A	7: 106,602,886	V384L	possibly damaging	Het
Gne	A	T	4: 44,039,033	V647E	possibly damaging	Het
Grb14	G	A	2: 64,914,727	Q96*	probably null	Het
Irak2	A	G	6: 113,638,564	Y6C	probably damaging	Het
Kel	T	A	6: 41,703,031	N75I	probably damaging	Het
Lgr4	T	A	2: 110,011,787	F706I	possibly damaging	Het
Lox	A	T	18: 52,528,883	S149R	probably benign	Het
Lrrc66	T	G	5: 73,610,944	D218A	probably benign	Het
Luc7l	C	T	17: 26,266,322	R99W	probably damaging	Het
Megf10	T	C	18: 57,252,896	V327A	probably benign	Het
Mthfd1l	G	T	10: 4,047,976		probably null	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myh8	G	T	11: 67,284,532		probably null	Het
Olfr1463	A	T	19: 13,235,060	D270V	possibly damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pgf	C	T	12: 85,169,385	R153K	probably benign	Het
Pramef8	A	T	4: 143,417,600	Q172L	probably damaging	Het
Prdm2	A	G	4: 143,135,265	V485A	probably damaging	Het
Rag1	T	C	2: 101,642,683	T705A	probably damaging	Het
Rflna	A	C	5: 125,003,710	D48A	possibly damaging	Het
Rnf148	A	T	6: 23,654,457	I180N	probably damaging	Het
Rtn4	T	A	11: 29,706,475	S94T	probably damaging	Het
Scn11a	G	A	9: 119,811,160	T223I	probably benign	Het
Scube2	T	A	7: 109,837,120		probably benign	Het
Sept14	T	C	5: 129,697,908	I68V	probably benign	Het
Sil1	A	T	18: 35,266,857	L365Q	possibly damaging	Het
Sirt1	A	G	10: 63,321,736		probably benign	Het
Slc9a1	T	C	4: 133,420,499		probably benign	Het
Smpdl3a	A	G	10: 57,811,240	T355A	probably damaging	Het
Syne2	T	C	12: 76,094,336	I6074T	probably damaging	Het
Thbs2	T	A	17: 14,680,325	H540L	probably benign	Het
Tsc22d4	T	C	5: 137,768,021	S450P	probably benign	Het
Tshr	C	A	12: 91,538,226	S54*	probably null	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Uncx	G	T	5: 139,544,187	C65F	probably damaging	Het
Vmn1r87	A	T	7: 13,131,829	M177K	probably damaging	Het
Vmn2r56	A	T	7: 12,710,308	C466S	probably benign	Het
Wnk1	G	A	6: 119,948,505	P1831S	probably damaging	Het
Zfp820	T	C	17: 21,818,920	S476G	probably benign	Het

Other mutations in Gtf3c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Gtf3c1	APN	7	125644258	missense	probably benign	0.15
IGL00535:Gtf3c1	APN	7	125644153	missense	probably benign	0.00
IGL00778:Gtf3c1	APN	7	125667374	missense	probably damaging	1.00
IGL00832:Gtf3c1	APN	7	125654460	splice site	probably benign
IGL01383:Gtf3c1	APN	7	125699500	missense	probably damaging	1.00
IGL01472:Gtf3c1	APN	7	125651054	splice site	probably benign
IGL01743:Gtf3c1	APN	7	125663415	missense	probably damaging	1.00
IGL01867:Gtf3c1	APN	7	125662376	missense	probably benign	0.44
IGL02016:Gtf3c1	APN	7	125668039	missense	probably damaging	1.00
IGL02096:Gtf3c1	APN	7	125659112	missense	probably damaging	0.98
IGL02121:Gtf3c1	APN	7	125646731	nonsense	probably null
IGL02226:Gtf3c1	APN	7	125667990	splice site	probably null
IGL02376:Gtf3c1	APN	7	125668996	missense	probably benign	0.41
IGL02581:Gtf3c1	APN	7	125646515	missense	possibly damaging	0.80
IGL02750:Gtf3c1	APN	7	125676512	missense	probably damaging	1.00
IGL03063:Gtf3c1	APN	7	125646503	missense	possibly damaging	0.72
IGL03167:Gtf3c1	APN	7	125670580	critical splice acceptor site	probably null
Godiva	UTSW	7	125645534	missense	possibly damaging	0.86
R0052:Gtf3c1	UTSW	7	125667971	splice site	probably null
R0266:Gtf3c1	UTSW	7	125644134	missense	possibly damaging	0.83
R0378:Gtf3c1	UTSW	7	125647614	nonsense	probably null
R0387:Gtf3c1	UTSW	7	125681104	missense	probably damaging	1.00
R0426:Gtf3c1	UTSW	7	125663016	nonsense	probably null
R0458:Gtf3c1	UTSW	7	125644134	missense	possibly damaging	0.83
R0613:Gtf3c1	UTSW	7	125644134	missense	possibly damaging	0.83
R0634:Gtf3c1	UTSW	7	125657477	unclassified	probably benign
R0904:Gtf3c1	UTSW	7	125668842	splice site	probably benign
R1051:Gtf3c1	UTSW	7	125707649	missense	probably damaging	1.00
R1481:Gtf3c1	UTSW	7	125693138	critical splice donor site	probably null
R1590:Gtf3c1	UTSW	7	125676661	missense	possibly damaging	0.90
R1782:Gtf3c1	UTSW	7	125667074	missense	probably damaging	1.00
R1981:Gtf3c1	UTSW	7	125644272	missense	possibly damaging	0.96
R2513:Gtf3c1	UTSW	7	125681173	missense	probably benign	0.01
R2697:Gtf3c1	UTSW	7	125643954	missense	probably damaging	0.98
R3963:Gtf3c1	UTSW	7	125693225	splice site	probably null
R4125:Gtf3c1	UTSW	7	125647450	nonsense	probably null
R4127:Gtf3c1	UTSW	7	125647450	nonsense	probably null
R4646:Gtf3c1	UTSW	7	125659094	missense	possibly damaging	0.66
R4653:Gtf3c1	UTSW	7	125674100	missense	probably benign	0.23
R4668:Gtf3c1	UTSW	7	125667338	missense	probably damaging	1.00
R4803:Gtf3c1	UTSW	7	125663540	missense	probably damaging	1.00
R5138:Gtf3c1	UTSW	7	125647492	missense	probably benign	0.05
R5149:Gtf3c1	UTSW	7	125668037	missense	probably damaging	0.99
R5286:Gtf3c1	UTSW	7	125663408	missense	possibly damaging	0.79
R5437:Gtf3c1	UTSW	7	125667368	missense	probably damaging	1.00
R5493:Gtf3c1	UTSW	7	125670544	missense	probably damaging	1.00
R5610:Gtf3c1	UTSW	7	125703945	missense	possibly damaging	0.94
R5656:Gtf3c1	UTSW	7	125662654	missense	probably benign	0.27
R5754:Gtf3c1	UTSW	7	125644065	missense	possibly damaging	0.86
R5969:Gtf3c1	UTSW	7	125645676	missense	possibly damaging	0.91
R6009:Gtf3c1	UTSW	7	125647430	missense	possibly damaging	0.66
R6223:Gtf3c1	UTSW	7	125676625	missense	probably benign	0.01
R6580:Gtf3c1	UTSW	7	125644347	missense	probably benign	0.02
R6628:Gtf3c1	UTSW	7	125668074	missense	probably benign	0.04
R6774:Gtf3c1	UTSW	7	125641621	missense	possibly damaging	0.93
R6781:Gtf3c1	UTSW	7	125659197	nonsense	probably null
R6978:Gtf3c1	UTSW	7	125645534	missense	possibly damaging	0.86
R7078:Gtf3c1	UTSW	7	125645742	missense	possibly damaging	0.95
R7096:Gtf3c1	UTSW	7	125696559	critical splice acceptor site	probably null
R7146:Gtf3c1	UTSW	7	125672821	missense	possibly damaging	0.48
R7246:Gtf3c1	UTSW	7	125669094
R7330:Gtf3c1	UTSW	7	125703883	missense	probably benign	0.36
R7345:Gtf3c1	UTSW	7	125645670	missense	probably damaging	1.00
R7480:Gtf3c1	UTSW	7	125642541	missense	probably benign	0.22
R7490:Gtf3c1	UTSW	7	125647491	missense	probably damaging	0.98
R7555:Gtf3c1	UTSW	7	125645670	missense	probably damaging	1.00
R7895:Gtf3c1	UTSW	7	125672822	missense	possibly damaging	0.94
R7949:Gtf3c1	UTSW	7	125651081	missense	probably benign
R8123:Gtf3c1	UTSW	7	125704024	start gained	probably benign
R8295:Gtf3c1	UTSW	7	125663062	missense	probably benign	0.01
R8421:Gtf3c1	UTSW	7	125698970	missense	probably damaging	1.00
R8438:Gtf3c1	UTSW	7	125642529	nonsense	probably null
R8517:Gtf3c1	UTSW	7	125654551	missense	probably damaging	1.00
X0065:Gtf3c1	UTSW	7	125641690	missense	probably damaging	1.00
Z1176:Gtf3c1	UTSW	7	125703964	missense	probably damaging	0.99
Z1177:Gtf3c1	UTSW	7	125667122	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TGATACCCAGCTAAAATGGCACCTTTC -3'
(R):5'- AGTGAAGTAACCACTCTCTTCTCCTGC -3'

Sequencing Primer
(F):5'- CCCACTGTGTGACCATATAGG -3'
(R):5'- CAGGGTTGACGCTGGGAAG -3'

Posted On

2014-08-21