Incidental Mutation 'R0658:Gtf3c1'
ID218806
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
MMRRC Submission 038843-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0658 (G1)
Quality Score76
Status Validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125698962 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 146 (F146L)
Ref Sequence ENSEMBL: ENSMUSP00000145607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205444] [ENSMUST00000205659] [ENSMUST00000206127]
Predicted Effect probably damaging
Transcript: ENSMUST00000055506
AA Change: F247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: F247L

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205347
Predicted Effect probably damaging
Transcript: ENSMUST00000205444
AA Change: F247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000205659
AA Change: F247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205697
Predicted Effect probably damaging
Transcript: ENSMUST00000206127
AA Change: F146L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7661 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Acsl3 A G 1: 78,701,287 D520G probably damaging Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fmo2 A T 1: 162,876,774 L521Q possibly damaging Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Kel T A 6: 41,703,031 N75I probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Scube2 T A 7: 109,837,120 probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Slc9a1 T C 4: 133,420,499 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 intron probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1481:Gtf3c1 UTSW 7 125693138 critical splice donor site probably null
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R2697:Gtf3c1 UTSW 7 125643954 missense probably damaging 0.98
R3963:Gtf3c1 UTSW 7 125693225 unclassified probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4653:Gtf3c1 UTSW 7 125674100 missense probably benign 0.23
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5754:Gtf3c1 UTSW 7 125644065 missense possibly damaging 0.86
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6223:Gtf3c1 UTSW 7 125676625 missense probably benign 0.01
R6580:Gtf3c1 UTSW 7 125644347 missense probably benign 0.02
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense probably damaging 0.98
R7555:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATACCCAGCTAAAATGGCACCTTTC -3'
(R):5'- AGTGAAGTAACCACTCTCTTCTCCTGC -3'

Sequencing Primer
(F):5'- CCCACTGTGTGACCATATAGG -3'
(R):5'- CAGGGTTGACGCTGGGAAG -3'
Posted On2014-08-21