Incidental Mutation 'R5765:Nfe2l3'
ID446223
Institutional Source Beutler Lab
Gene Symbol Nfe2l3
Ensembl Gene ENSMUSG00000029832
Gene Namenuclear factor, erythroid derived 2, like 3
SynonymsNrf3
MMRRC Submission 043366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5765 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location51432670-51458768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51457246 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 262 (D262G)
Ref Sequence ENSEMBL: ENSMUSP00000005103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005103] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000160133] [ENSMUST00000203954] [ENSMUST00000204158]
Predicted Effect probably damaging
Transcript: ENSMUST00000005103
AA Change: D262G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005103
Gene: ENSMUSG00000029832
AA Change: D262G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
BRLZ 539 603 3.68e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090002
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160133
SMART Domains Protein: ENSMUSP00000124920
Gene: ENSMUSG00000029832

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203954
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204158
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,153,240 probably benign Het
4833423E24Rik T G 2: 85,484,194 probably null Het
Abcf2 T C 5: 24,573,423 R246G probably damaging Het
Adamts19 G T 18: 59,052,582 C1176F probably damaging Het
Adh7 G A 3: 138,226,329 V235I probably benign Het
Caprin2 G C 6: 148,843,168 P701A probably damaging Het
Casp7 T C 19: 56,433,883 V110A possibly damaging Het
Cd1d2 A T 3: 86,987,242 M106L probably benign Het
Cntnap2 C T 6: 46,529,815 probably benign Het
Cpm A G 10: 117,671,733 I252V probably benign Het
Dnaaf2 A C 12: 69,192,853 I631M probably damaging Het
Doxl2 C T 6: 48,978,537 P694S probably damaging Het
Fam117b A G 1: 59,970,472 probably null Het
Fbxw22 T C 9: 109,384,996 M251V probably benign Het
Fignl1 T C 11: 11,802,011 probably null Het
Foxp1 G A 6: 99,015,462 L156F probably damaging Het
Gdap1 A T 1: 17,161,426 M332L probably benign Het
H2-M3 T C 17: 37,272,443 F265S probably damaging Het
Il1rl1 C T 1: 40,461,943 A493V probably benign Het
Iqce A G 5: 140,666,140 S359P probably damaging Het
Kif2b C T 11: 91,577,242 E72K probably benign Het
Luzp1 T C 4: 136,541,029 S188P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mocs2 A G 13: 114,826,156 probably null Het
Mtnr1b T C 9: 15,863,163 Y200C probably damaging Het
Nalcn C T 14: 123,464,726 V458I possibly damaging Het
Nbea C T 3: 56,005,298 V1023I probably benign Het
Nbeal1 T A 1: 60,291,847 V2205D probably damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Pcdhac1 A T 18: 37,090,319 R62* probably null Het
Pcdhga1 A G 18: 37,663,661 T573A probably benign Het
Plin4 C T 17: 56,102,470 C1276Y possibly damaging Het
Ppp6r1 C A 7: 4,642,208 R220L possibly damaging Het
Ptprz1 T G 6: 23,000,236 V775G probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc17a6 A G 7: 51,625,501 T103A possibly damaging Het
Spock1 A T 13: 57,429,404 L404Q probably benign Het
Stradb C A 1: 58,992,744 H272N probably benign Het
Strn3 A G 12: 51,633,627 S397P probably benign Het
Synpo2l C T 14: 20,666,130 R126H possibly damaging Het
Tas2r104 A G 6: 131,685,273 Y158H probably benign Het
Tiparp T A 3: 65,531,350 I29N possibly damaging Het
Tnpo1 G A 13: 98,859,841 T484M probably benign Het
Tsc22d4 A G 5: 137,758,543 I78V probably benign Het
Ugt2b1 T C 5: 86,919,406 Y386C probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Vmn2r116 G A 17: 23,401,404 C704Y probably damaging Het
Vmn2r97 T A 17: 18,947,180 Y565* probably null Het
Zfand2b T A 1: 75,170,527 probably null Het
Zzef1 C T 11: 72,821,937 Q228* probably null Het
Other mutations in Nfe2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02705:Nfe2l3 APN 6 51433118 missense probably damaging 0.96
IGL02803:Nfe2l3 APN 6 51457311 missense possibly damaging 0.50
R0277:Nfe2l3 UTSW 6 51457468 missense probably benign 0.30
R0693:Nfe2l3 UTSW 6 51433054 missense possibly damaging 0.94
R1397:Nfe2l3 UTSW 6 51433294 missense probably benign 0.00
R1455:Nfe2l3 UTSW 6 51457764 missense possibly damaging 0.91
R1541:Nfe2l3 UTSW 6 51457605 missense probably damaging 0.98
R1753:Nfe2l3 UTSW 6 51433412 missense probably null 0.96
R1946:Nfe2l3 UTSW 6 51457315 missense probably damaging 1.00
R2034:Nfe2l3 UTSW 6 51458370 missense possibly damaging 0.50
R3807:Nfe2l3 UTSW 6 51457377 nonsense probably null
R3932:Nfe2l3 UTSW 6 51456615 missense possibly damaging 0.94
R4271:Nfe2l3 UTSW 6 51456634 missense probably damaging 0.99
R4604:Nfe2l3 UTSW 6 51451012 missense probably damaging 0.99
R4816:Nfe2l3 UTSW 6 51456624 missense probably damaging 0.99
R5893:Nfe2l3 UTSW 6 51457852 missense probably damaging 1.00
R7378:Nfe2l3 UTSW 6 51457296 nonsense probably null
R7490:Nfe2l3 UTSW 6 51457544 missense possibly damaging 0.65
R7624:Nfe2l3 UTSW 6 51458272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACAATGTGGGCTTTAGCTTC -3'
(R):5'- TTGTGCCTGTGAAGACCTTG -3'

Sequencing Primer
(F):5'- GGGCTTTAGCTTCAAATGTATCGAC -3'
(R):5'- AAGACCTTGCTGATGGATCTC -3'
Posted On2016-11-21