Incidental Mutation 'R4816:Nfe2l3'
ID369792
Institutional Source Beutler Lab
Gene Symbol Nfe2l3
Ensembl Gene ENSMUSG00000029832
Gene Namenuclear factor, erythroid derived 2, like 3
SynonymsNrf3
MMRRC Submission 042434-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4816 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location51432670-51458768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51456624 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000124920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005103] [ENSMUST00000069949] [ENSMUST00000090002] [ENSMUST00000160133] [ENSMUST00000203954] [ENSMUST00000204158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005103
AA Change: S239P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005103
Gene: ENSMUSG00000029832
AA Change: S239P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
BRLZ 539 603 3.68e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069949
SMART Domains Protein: ENSMUSP00000067491
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 5.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090002
SMART Domains Protein: ENSMUSP00000087453
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
low complexity region 186 295 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160133
AA Change: S239P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124920
Gene: ENSMUSG00000029832
AA Change: S239P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203954
SMART Domains Protein: ENSMUSP00000145028
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 22 94 1.51e-23 SMART
RRM 113 185 7.64e-20 SMART
low complexity region 198 307 N/A INTRINSIC
low complexity region 322 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204158
SMART Domains Protein: ENSMUSP00000145383
Gene: ENSMUSG00000004980

DomainStartEndE-ValueType
RRM 10 82 1.51e-23 SMART
RRM 101 173 7.64e-20 SMART
Pfam:HnRNPA1 245 282 9.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204885
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Nfe2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02705:Nfe2l3 APN 6 51433118 missense probably damaging 0.96
IGL02803:Nfe2l3 APN 6 51457311 missense possibly damaging 0.50
R0277:Nfe2l3 UTSW 6 51457468 missense probably benign 0.30
R0693:Nfe2l3 UTSW 6 51433054 missense possibly damaging 0.94
R1397:Nfe2l3 UTSW 6 51433294 missense probably benign 0.00
R1455:Nfe2l3 UTSW 6 51457764 missense possibly damaging 0.91
R1541:Nfe2l3 UTSW 6 51457605 missense probably damaging 0.98
R1753:Nfe2l3 UTSW 6 51433412 missense probably null 0.96
R1946:Nfe2l3 UTSW 6 51457315 missense probably damaging 1.00
R2034:Nfe2l3 UTSW 6 51458370 missense possibly damaging 0.50
R3807:Nfe2l3 UTSW 6 51457377 nonsense probably null
R3932:Nfe2l3 UTSW 6 51456615 missense possibly damaging 0.94
R4271:Nfe2l3 UTSW 6 51456634 missense probably damaging 0.99
R4604:Nfe2l3 UTSW 6 51451012 missense probably damaging 0.99
R5765:Nfe2l3 UTSW 6 51457246 missense probably damaging 1.00
R5893:Nfe2l3 UTSW 6 51457852 missense probably damaging 1.00
R7378:Nfe2l3 UTSW 6 51457296 nonsense probably null
R7490:Nfe2l3 UTSW 6 51457544 missense possibly damaging 0.65
R7624:Nfe2l3 UTSW 6 51458272 missense probably damaging 1.00
Z1177:Nfe2l3 UTSW 6 51433297 missense not run
Predicted Primers PCR Primer
(F):5'- GAAGCATTTGTCTACTAGAAATCCG -3'
(R):5'- TGGCAAATTGCTGTGTCTTCC -3'

Sequencing Primer
(F):5'- TCTACTGAGTGAGTTCCAGAACAGC -3'
(R):5'- TCCAAGTAGGAGAGTCTTCAATCC -3'
Posted On2016-02-04