Incidental Mutation 'R5830:Gfpt2'
ID449276
Institutional Source Beutler Lab
Gene Symbol Gfpt2
Ensembl Gene ENSMUSG00000020363
Gene Nameglutamine fructose-6-phosphate transaminase 2
SynonymsGFAT2
MMRRC Submission 043219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5830 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49794178-49838613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49809061 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 81 (E81G)
Ref Sequence ENSEMBL: ENSMUSP00000020629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020629]
Predicted Effect probably benign
Transcript: ENSMUST00000020629
AA Change: E81G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020629
Gene: ENSMUSG00000020363
AA Change: E81G

DomainStartEndE-ValueType
Pfam:GATase_6 72 212 1e-19 PFAM
Pfam:GATase_4 75 206 1.6e-7 PFAM
Pfam:GATase_7 90 209 8.2e-16 PFAM
Pfam:SIS 363 492 1.7e-38 PFAM
Pfam:SIS 534 665 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130129
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobec3 A T 15: 79,899,067 N115I possibly damaging Het
Arl14ep T C 2: 106,969,194 S101G possibly damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
Ccdc40 C A 11: 119,242,746 H571N probably benign Het
Cdc42bpb G A 12: 111,345,582 R99* probably null Het
Cdyl2 A G 8: 116,595,084 Y235H probably benign Het
Chmp2a T C 7: 13,032,112 D161G probably damaging Het
Ep400 A T 5: 110,683,996 W2091R unknown Het
Epha8 G A 4: 136,936,390 Q452* probably null Het
Fbn2 A G 18: 58,114,469 F451S probably benign Het
Fndc1 C A 17: 7,789,086 R72L possibly damaging Het
Gpr155 A G 2: 73,370,089 V358A possibly damaging Het
Hnrnpk A T 13: 58,397,734 Y92* probably null Het
Il34 A G 8: 110,748,691 V71A probably damaging Het
Inpp5e A G 2: 26,400,415 F416L probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Kdsr A G 1: 106,747,532 S125P possibly damaging Het
Ldb1 T A 19: 46,034,118 M307L probably benign Het
Lrr1 T A 12: 69,178,671 S374T possibly damaging Het
Mtmr2 A G 9: 13,801,978 I412V probably benign Het
Ncor1 T C 11: 62,344,763 I298V possibly damaging Het
Ndst1 A G 18: 60,703,838 F384L probably damaging Het
Nlrc5 A G 8: 94,472,914 E51G probably damaging Het
Obox6 G A 7: 15,834,457 H165Y possibly damaging Het
Olfr181 T A 16: 58,926,094 H159L possibly damaging Het
Pde8b A T 13: 95,041,890 F582Y probably benign Het
Pik3r4 C A 9: 105,644,824 Y196* probably null Het
Pink1 A T 4: 138,316,014 M1K probably null Het
Scn7a A T 2: 66,714,051 Y365* probably null Het
Sec16a A T 2: 26,440,841 D387E probably benign Het
Sel1l A T 12: 91,833,171 F127Y probably damaging Het
Syt7 T A 19: 10,421,787 N82K probably damaging Het
Zfp358 G T 8: 3,495,846 V143L probably benign Het
Zkscan2 T C 7: 123,480,100 N878S possibly damaging Het
Other mutations in Gfpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Gfpt2 APN 11 49809123 missense probably benign 0.00
IGL01451:Gfpt2 APN 11 49807690 splice site probably benign
IGL01490:Gfpt2 APN 11 49827127 splice site probably benign
IGL01550:Gfpt2 APN 11 49824323 splice site probably null
IGL01552:Gfpt2 APN 11 49805005 nonsense probably null
IGL02349:Gfpt2 APN 11 49807703 missense probably benign 0.02
IGL02815:Gfpt2 APN 11 49823257 missense possibly damaging 0.89
plethora UTSW 11 49824441 missense probably damaging 1.00
R0525:Gfpt2 UTSW 11 49829775 missense probably benign 0.06
R0539:Gfpt2 UTSW 11 49832898 missense probably damaging 1.00
R1055:Gfpt2 UTSW 11 49827211 missense probably damaging 1.00
R1178:Gfpt2 UTSW 11 49823309 missense probably benign 0.42
R1340:Gfpt2 UTSW 11 49832861 missense probably damaging 1.00
R2372:Gfpt2 UTSW 11 49807715 missense probably benign 0.00
R4154:Gfpt2 UTSW 11 49835778 splice site probably null
R4476:Gfpt2 UTSW 11 49824342 missense probably benign 0.17
R4679:Gfpt2 UTSW 11 49823737 missense probably benign 0.00
R4863:Gfpt2 UTSW 11 49810970 missense probably benign 0.06
R5113:Gfpt2 UTSW 11 49823799 missense probably damaging 1.00
R5509:Gfpt2 UTSW 11 49827146 missense possibly damaging 0.75
R6435:Gfpt2 UTSW 11 49835651 missense probably benign 0.00
R7079:Gfpt2 UTSW 11 49837751 missense possibly damaging 0.77
R7135:Gfpt2 UTSW 11 49804955 missense probably damaging 1.00
R7261:Gfpt2 UTSW 11 49823251 missense possibly damaging 0.77
R7294:Gfpt2 UTSW 11 49818608 nonsense probably null
R7384:Gfpt2 UTSW 11 49810990 missense possibly damaging 0.56
R7778:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
R7806:Gfpt2 UTSW 11 49823315 missense probably benign
R7824:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
R8245:Gfpt2 UTSW 11 49823958 missense probably benign 0.01
R8262:Gfpt2 UTSW 11 49823780 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCACCTTGCCATAGTGGTG -3'
(R):5'- ACTCTGGCCAGGATCATCTC -3'

Sequencing Primer
(F):5'- AGGCGTGACATTAATTCCCG -3'
(R):5'- GGATCATCTCTGACAGGTCATTCAG -3'
Posted On2016-12-20