Incidental Mutation 'R5822:Pan2'
ID449987
Institutional Source Beutler Lab
Gene Symbol Pan2
Ensembl Gene ENSMUSG00000005682
Gene NamePAN2 poly(A) specific ribonuclease subunit
SynonymsUsp52, 1200014O24Rik
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128303335-128321358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128320380 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1142 (L1142P)
Ref Sequence ENSEMBL: ENSMUSP00000151874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005825] [ENSMUST00000026446] [ENSMUST00000218315] [ENSMUST00000219037] [ENSMUST00000219721] [ENSMUST00000219836]
Predicted Effect probably damaging
Transcript: ENSMUST00000005825
AA Change: L1169P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005825
Gene: ENSMUSG00000005682
AA Change: L1169P

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCOP:d1tbga_ 151 357 4e-11 SMART
Blast:WD40 225 271 4e-11 BLAST
low complexity region 412 425 N/A INTRINSIC
Pfam:UCH 515 920 2.6e-15 PFAM
Pfam:UCH_1 516 897 9.7e-70 PFAM
low complexity region 938 949 N/A INTRINSIC
EXOIII 972 1155 1.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026446
SMART Domains Protein: ENSMUSP00000026446
Gene: ENSMUSG00000025381

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 27 171 1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218315
AA Change: L1160P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218496
Predicted Effect probably benign
Transcript: ENSMUST00000219037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219255
Predicted Effect probably damaging
Transcript: ENSMUST00000219721
AA Change: L1142P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220391
Meta Mutation Damage Score 0.9315 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deadenylase that functions as the catalytic subunit of the polyadenylate binding protein dependent poly(A) nuclease complex. The encoded protein is a magnesium dependent 3' to 5' exoribonuclease that is involved in the degradation of cytoplasmic mRNAs. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Pan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pan2 APN 10 128312926 nonsense probably null
IGL02183:Pan2 APN 10 128309075 missense possibly damaging 0.74
IGL02219:Pan2 APN 10 128320352 missense probably benign 0.04
IGL02514:Pan2 APN 10 128310741 missense possibly damaging 0.94
IGL02552:Pan2 APN 10 128319027 missense probably damaging 1.00
IGL02623:Pan2 APN 10 128312899 missense probably benign
IGL02860:Pan2 APN 10 128310735 nonsense probably null
IGL03104:Pan2 APN 10 128315663 splice site probably benign
IGL03372:Pan2 APN 10 128315127 missense probably benign 0.09
R0541:Pan2 UTSW 10 128308222 missense possibly damaging 0.87
R0585:Pan2 UTSW 10 128310515 critical splice donor site probably null
R1079:Pan2 UTSW 10 128318238 missense probably damaging 0.99
R1650:Pan2 UTSW 10 128317899 missense probably damaging 1.00
R1847:Pan2 UTSW 10 128304378 missense possibly damaging 0.71
R1867:Pan2 UTSW 10 128313181 missense probably damaging 1.00
R1903:Pan2 UTSW 10 128308368 missense probably damaging 0.98
R1975:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1976:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1977:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R2136:Pan2 UTSW 10 128313637 missense possibly damaging 0.95
R2162:Pan2 UTSW 10 128304222 missense possibly damaging 0.90
R2512:Pan2 UTSW 10 128304457 missense probably damaging 1.00
R2566:Pan2 UTSW 10 128313897 missense probably damaging 1.00
R2900:Pan2 UTSW 10 128308342 missense probably benign
R3957:Pan2 UTSW 10 128315177 missense probably damaging 0.99
R4571:Pan2 UTSW 10 128308643 missense probably benign 0.05
R5112:Pan2 UTSW 10 128315595 nonsense probably null
R5120:Pan2 UTSW 10 128314995 critical splice donor site probably null
R5183:Pan2 UTSW 10 128317969 missense probably damaging 1.00
R5325:Pan2 UTSW 10 128317634 missense possibly damaging 0.59
R5539:Pan2 UTSW 10 128308133 missense probably benign 0.16
R5642:Pan2 UTSW 10 128308100 missense probably benign 0.00
R5740:Pan2 UTSW 10 128308164 missense probably damaging 1.00
R6766:Pan2 UTSW 10 128314512 missense possibly damaging 0.79
R6902:Pan2 UTSW 10 128315637 missense probably benign 0.33
R6946:Pan2 UTSW 10 128315637 missense probably benign 0.33
R7206:Pan2 UTSW 10 128314545 nonsense probably null
R7490:Pan2 UTSW 10 128308440 missense probably benign 0.00
R7715:Pan2 UTSW 10 128317723 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGTTTCTAGGAGACTGCG -3'
(R):5'- CAGACACTTCAGGAGCAGGTAG -3'

Sequencing Primer
(F):5'- ATAGAGATGGGGTGCCTGCC -3'
(R):5'- AGCAGGTAGGGGTATTATAATCTG -3'
Posted On2016-12-20