Incidental Mutation 'R5844:Cnksr1'
ID450580
Institutional Source Beutler Lab
Gene Symbol Cnksr1
Ensembl Gene ENSMUSG00000028841
Gene Nameconnector enhancer of kinase suppressor of Ras 1
Synonyms
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134228041-134238399 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 134228264 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030645] [ENSMUST00000055892] [ENSMUST00000105878] [ENSMUST00000169381]
Predicted Effect probably benign
Transcript: ENSMUST00000030645
SMART Domains Protein: ENSMUSP00000030645
Gene: ENSMUSG00000028841

DomainStartEndE-ValueType
SAM 4 70 1.44e-9 SMART
Pfam:CRIC_ras_sig 78 162 4.2e-26 PFAM
PDZ 206 276 1.48e-3 SMART
low complexity region 285 303 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PH 388 488 4.38e-19 SMART
coiled coil region 596 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055892
SMART Domains Protein: ENSMUSP00000051694
Gene: ENSMUSG00000048003

DomainStartEndE-ValueType
Pfam:Ion_trans 67 294 6.9e-34 PFAM
Pfam:PKD_channel 149 289 8.1e-8 PFAM
low complexity region 304 315 N/A INTRINSIC
coiled coil region 353 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105878
SMART Domains Protein: ENSMUSP00000101504
Gene: ENSMUSG00000048003

DomainStartEndE-ValueType
transmembrane domain 64 86 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146283
Predicted Effect probably benign
Transcript: ENSMUST00000169381
SMART Domains Protein: ENSMUSP00000131094
Gene: ENSMUSG00000048003

DomainStartEndE-ValueType
Pfam:Ion_trans 56 209 2.4e-11 PFAM
low complexity region 231 242 N/A INTRINSIC
coiled coil region 280 310 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several motifs involved in protein-protein interaction, including PDZ, PH (Pleckstrin homology), and SAM (sterile alpha motif) domains. The encoded protein acts as a scaffold component for receptor tyrosine kinase signaling and may mediate crosstalk between different signaling pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Cnksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Cnksr1 APN 4 134234701 missense probably benign 0.39
IGL01311:Cnksr1 APN 4 134230466 missense probably damaging 1.00
IGL01872:Cnksr1 APN 4 134228964 missense probably benign 0.13
IGL02082:Cnksr1 APN 4 134236052 missense probably damaging 1.00
IGL02405:Cnksr1 APN 4 134236281 missense possibly damaging 0.88
IGL02669:Cnksr1 APN 4 134230463 missense probably damaging 0.98
IGL02948:Cnksr1 APN 4 134235106 splice site probably null
IGL03037:Cnksr1 APN 4 134235106 splice site probably null
IGL03381:Cnksr1 APN 4 134232171 missense probably damaging 0.99
R0855:Cnksr1 UTSW 4 134233066 splice site probably benign
R1958:Cnksr1 UTSW 4 134228416 missense probably benign 0.02
R2049:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2140:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2141:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2142:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2389:Cnksr1 UTSW 4 134233746 missense probably benign 0.03
R2495:Cnksr1 UTSW 4 134232162 missense probably benign 0.00
R4596:Cnksr1 UTSW 4 134233878 missense possibly damaging 0.90
R4668:Cnksr1 UTSW 4 134232971 intron probably benign
R4896:Cnksr1 UTSW 4 134229675 splice site probably null
R5367:Cnksr1 UTSW 4 134230214 missense possibly damaging 0.94
R5673:Cnksr1 UTSW 4 134235188 missense probably damaging 1.00
R6153:Cnksr1 UTSW 4 134233893 missense probably damaging 1.00
R7207:Cnksr1 UTSW 4 134235123 missense possibly damaging 0.75
R7261:Cnksr1 UTSW 4 134235773 intron probably null
Predicted Primers PCR Primer
(F):5'- TTTGGTGGAAAAGCGGCTC -3'
(R):5'- AGCTATACTCAGAGGGCCTG -3'

Sequencing Primer
(F):5'- GCGGCTCTCGTGTAAAATAAAC -3'
(R):5'- TCAGAGGGCCTGAGAACCTG -3'
Posted On2016-12-20