Incidental Mutation 'R5720:Serpina12'
ID 451421
Institutional Source Beutler Lab
Gene Symbol Serpina12
Ensembl Gene ENSMUSG00000041567
Gene Name serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonyms vaspin
MMRRC Submission 043188-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5720 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 104028769-104044443 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104038304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 23 (D23G)
Ref Sequence ENSEMBL: ENSMUSP00000045572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043915]
AlphaFold Q7TMF5
Predicted Effect probably benign
Transcript: ENSMUST00000043915
AA Change: D23G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: D23G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 57 411 1.02e-139 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,203,687 N1165K probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
BC037034 A G 5: 138,263,702 V44A probably benign Het
Cdh23 T C 10: 60,393,023 T1125A possibly damaging Het
Ctf1 A T 7: 127,717,002 probably null Het
Defb26 T C 2: 152,508,202 N53D possibly damaging Het
Dhtkd1 T C 2: 5,903,014 T787A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxl7 A G 15: 26,552,893 L96P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr65 A T 12: 98,275,102 S5C probably damaging Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Itga8 G A 2: 12,111,087 S76L probably damaging Het
Mpdz A T 4: 81,287,694 F1810Y probably damaging Het
Nfrkb T C 9: 31,394,742 L126P probably damaging Het
Olfr1250 T C 2: 89,656,955 Y162C probably benign Het
Primpol A G 8: 46,581,642 V417A probably damaging Het
Pus1 C T 5: 110,777,718 E79K probably damaging Het
Rspo2 C T 15: 43,169,814 C4Y probably benign Het
Serpind1 A T 16: 17,339,832 R297S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc17a6 C T 7: 51,625,397 P68L probably damaging Het
Slc6a5 C T 7: 49,956,516 P724L possibly damaging Het
Spaca7 A G 8: 12,599,004 E166G possibly damaging Het
Supt5 A G 7: 28,322,568 S345P probably damaging Het
Syne2 G A 12: 75,967,667 D3211N probably benign Het
Tmem132e G A 11: 82,442,450 probably null Het
Zfp384 T C 6: 125,036,624 S536P probably benign Het
Other mutations in Serpina12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Serpina12 APN 12 104031114 missense probably benign 0.01
IGL00976:Serpina12 APN 12 104032528 missense probably damaging 1.00
IGL01592:Serpina12 APN 12 104038122 missense probably damaging 1.00
IGL02355:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02362:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02648:Serpina12 APN 12 104038008 missense probably benign 0.02
IGL03011:Serpina12 APN 12 104031138 missense possibly damaging 0.86
IGL03156:Serpina12 APN 12 104037899 missense probably damaging 1.00
sabina UTSW 12 104037920 missense probably damaging 1.00
PIT4305001:Serpina12 UTSW 12 104035717 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0448:Serpina12 UTSW 12 104038095 missense probably benign 0.20
R0465:Serpina12 UTSW 12 104037845 missense probably benign 0.04
R0480:Serpina12 UTSW 12 104035701 missense probably damaging 1.00
R0498:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R0503:Serpina12 UTSW 12 104031159 missense probably damaging 0.97
R0581:Serpina12 UTSW 12 104031140 missense probably damaging 0.97
R1393:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R1847:Serpina12 UTSW 12 104032510 missense probably damaging 1.00
R1956:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R3125:Serpina12 UTSW 12 104037983 missense probably benign
R4093:Serpina12 UTSW 12 104037924 missense probably damaging 1.00
R4584:Serpina12 UTSW 12 104038352 missense unknown
R4897:Serpina12 UTSW 12 104037797 missense possibly damaging 0.60
R5117:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R5167:Serpina12 UTSW 12 104037920 missense probably damaging 1.00
R5344:Serpina12 UTSW 12 104035548 splice site probably null
R6011:Serpina12 UTSW 12 104035734 missense probably damaging 1.00
R6027:Serpina12 UTSW 12 104031077 missense probably benign 0.01
R6170:Serpina12 UTSW 12 104038241 missense probably benign 0.03
R7538:Serpina12 UTSW 12 104038328 missense unknown
R7899:Serpina12 UTSW 12 104038265 missense probably benign 0.01
R9649:Serpina12 UTSW 12 104038058 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAAGTTGAAGCCCTCCC -3'
(R):5'- TCCCATGGGTCTTCCTGATG -3'

Sequencing Primer
(F):5'- AGTTGAAGCCCTCCCGGATTTC -3'
(R):5'- CCATGGGTCTTCCTGATGGCTAAG -3'
Posted On 2017-01-03