Mutagenetix > Incidental Mutation

Incidental Mutation 'R5720:Serpina12'

451421

Institutional Source

Beutler Lab

Gene Symbol

Serpina12

Ensembl Gene

ENSMUSG00000041567

Gene Name

serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12

Synonyms

vaspin

MMRRC Submission

043188-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104028769-104044443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104038304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 23 (D23G)

Ref Sequence

ENSEMBL: ENSMUSP00000045572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043915]

AlphaFold

Q7TMF5

Predicted Effect

probably benign
Transcript: ENSMUST00000043915
AA Change: D23G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: D23G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SERPIN	57	411	1.02e-139	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,203,687	N1165K	probably benign	Het
Arhgef10l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	4: 140,581,619		probably benign	Het
BC037034	A	G	5: 138,263,702	V44A	probably benign	Het
Cdh23	T	C	10: 60,393,023	T1125A	possibly damaging	Het
Ctf1	A	T	7: 127,717,002		probably null	Het
Defb26	T	C	2: 152,508,202	N53D	possibly damaging	Het
Dhtkd1	T	C	2: 5,903,014	T787A	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fbxl7	A	G	15: 26,552,893	L96P	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gpr65	A	T	12: 98,275,102	S5C	probably damaging	Het
Greb1l	G	A	18: 10,542,427	E1341K	probably damaging	Het
Itga8	G	A	2: 12,111,087	S76L	probably damaging	Het
Mpdz	A	T	4: 81,287,694	F1810Y	probably damaging	Het
Nfrkb	T	C	9: 31,394,742	L126P	probably damaging	Het
Olfr1250	T	C	2: 89,656,955	Y162C	probably benign	Het
Primpol	A	G	8: 46,581,642	V417A	probably damaging	Het
Pus1	C	T	5: 110,777,718	E79K	probably damaging	Het
Rspo2	C	T	15: 43,169,814	C4Y	probably benign	Het
Serpind1	A	T	16: 17,339,832	R297S	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc17a6	C	T	7: 51,625,397	P68L	probably damaging	Het
Slc6a5	C	T	7: 49,956,516	P724L	possibly damaging	Het
Spaca7	A	G	8: 12,599,004	E166G	possibly damaging	Het
Supt5	A	G	7: 28,322,568	S345P	probably damaging	Het
Syne2	G	A	12: 75,967,667	D3211N	probably benign	Het
Tmem132e	G	A	11: 82,442,450		probably null	Het
Zfp384	T	C	6: 125,036,624	S536P	probably benign	Het

Other mutations in Serpina12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Serpina12	APN	12	104031114	missense	probably benign	0.01
IGL00976:Serpina12	APN	12	104032528	missense	probably damaging	1.00
IGL01592:Serpina12	APN	12	104038122	missense	probably damaging	1.00
IGL02355:Serpina12	APN	12	104037881	missense	probably benign	0.00
IGL02362:Serpina12	APN	12	104037881	missense	probably benign	0.00
IGL02648:Serpina12	APN	12	104038008	missense	probably benign	0.02
IGL03011:Serpina12	APN	12	104031138	missense	possibly damaging	0.86
IGL03156:Serpina12	APN	12	104037899	missense	probably damaging	1.00
sabina	UTSW	12	104037920	missense	probably damaging	1.00
PIT4305001:Serpina12	UTSW	12	104035717	missense	probably damaging	1.00
R0038:Serpina12	UTSW	12	104037957	missense	probably damaging	1.00
R0038:Serpina12	UTSW	12	104037957	missense	probably damaging	1.00
R0448:Serpina12	UTSW	12	104038095	missense	probably benign	0.20
R0465:Serpina12	UTSW	12	104037845	missense	probably benign	0.04
R0480:Serpina12	UTSW	12	104035701	missense	probably damaging	1.00
R0498:Serpina12	UTSW	12	104035789	missense	probably damaging	1.00
R0503:Serpina12	UTSW	12	104031159	missense	probably damaging	0.97
R0581:Serpina12	UTSW	12	104031140	missense	probably damaging	0.97
R1393:Serpina12	UTSW	12	104037750	missense	possibly damaging	0.73
R1847:Serpina12	UTSW	12	104032510	missense	probably damaging	1.00
R1956:Serpina12	UTSW	12	104035789	missense	probably damaging	1.00
R3125:Serpina12	UTSW	12	104037983	missense	probably benign
R4093:Serpina12	UTSW	12	104037924	missense	probably damaging	1.00
R4584:Serpina12	UTSW	12	104038352	missense	unknown
R4897:Serpina12	UTSW	12	104037797	missense	possibly damaging	0.60
R5117:Serpina12	UTSW	12	104037750	missense	possibly damaging	0.73
R5167:Serpina12	UTSW	12	104037920	missense	probably damaging	1.00
R5344:Serpina12	UTSW	12	104035548	splice site	probably null
R6011:Serpina12	UTSW	12	104035734	missense	probably damaging	1.00
R6027:Serpina12	UTSW	12	104031077	missense	probably benign	0.01
R6170:Serpina12	UTSW	12	104038241	missense	probably benign	0.03
R7538:Serpina12	UTSW	12	104038328	missense	unknown
R7899:Serpina12	UTSW	12	104038265	missense	probably benign	0.01
R9649:Serpina12	UTSW	12	104038058	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGAAGTTGAAGCCCTCCC -3'
(R):5'- TCCCATGGGTCTTCCTGATG -3'

Sequencing Primer
(F):5'- AGTTGAAGCCCTCCCGGATTTC -3'
(R):5'- CCATGGGTCTTCCTGATGGCTAAG -3'

Posted On

2017-01-03