Incidental Mutation 'R3125:Serpina12'
ID264257
Institutional Source Beutler Lab
Gene Symbol Serpina12
Ensembl Gene ENSMUSG00000041567
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonymsvaspin
MMRRC Submission 040598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3125 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104028769-104044443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104037983 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 130 (T130I)
Ref Sequence ENSEMBL: ENSMUSP00000045572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043915]
Predicted Effect probably benign
Transcript: ENSMUST00000043915
AA Change: T130I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: T130I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 57 411 1.02e-139 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A T 6: 116,427,137 probably null Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cep135 T C 5: 76,621,363 probably null Het
Cfap206 T A 4: 34,716,310 H385L possibly damaging Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx32 T C 7: 133,725,356 Y332C probably damaging Het
Dlx1 T A 2: 71,532,396 W216R probably damaging Het
Dna2 G A 10: 62,949,202 A33T possibly damaging Het
Doxl2 A T 6: 48,975,371 I77F probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Fign T A 2: 63,978,700 Q742L possibly damaging Het
Hip1r A G 5: 124,000,141 D766G probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Icam5 A G 9: 21,036,658 I617M probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Ip6k3 T C 17: 27,157,542 Y65C probably damaging Het
Kif15 A C 9: 122,987,961 Q542P probably damaging Het
Kit G T 5: 75,647,827 A744S probably benign Het
Kit C T 5: 75,647,828 A744V probably null Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Ltbp4 C T 7: 27,327,778 R389Q possibly damaging Het
Map3k21 A T 8: 125,941,854 K726N probably benign Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Npb G A 11: 120,608,902 V103I possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr535 T C 7: 140,492,851 M71T probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Plin2 G T 4: 86,657,144 Y389* probably null Het
Pnpla6 G T 8: 3,534,670 G763C probably null Het
Pnpla7 A G 2: 25,042,138 D935G probably damaging Het
Prr29 A G 11: 106,374,885 S10G probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Slc6a18 A G 13: 73,677,802 F43S probably damaging Het
Stx6 C T 1: 155,158,908 P6S probably damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trpm2 T A 10: 77,911,374 N1430I probably damaging Het
Trpm6 C G 19: 18,854,431 H1553Q probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Serpina12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Serpina12 APN 12 104031114 missense probably benign 0.01
IGL00976:Serpina12 APN 12 104032528 missense probably damaging 1.00
IGL01592:Serpina12 APN 12 104038122 missense probably damaging 1.00
IGL02355:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02362:Serpina12 APN 12 104037881 missense probably benign 0.00
IGL02648:Serpina12 APN 12 104038008 missense probably benign 0.02
IGL03011:Serpina12 APN 12 104031138 missense possibly damaging 0.86
IGL03156:Serpina12 APN 12 104037899 missense probably damaging 1.00
sabina UTSW 12 104037920 missense probably damaging 1.00
PIT4305001:Serpina12 UTSW 12 104035717 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0038:Serpina12 UTSW 12 104037957 missense probably damaging 1.00
R0448:Serpina12 UTSW 12 104038095 missense probably benign 0.20
R0465:Serpina12 UTSW 12 104037845 missense probably benign 0.04
R0480:Serpina12 UTSW 12 104035701 missense probably damaging 1.00
R0498:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R0503:Serpina12 UTSW 12 104031159 missense probably damaging 0.97
R0581:Serpina12 UTSW 12 104031140 missense probably damaging 0.97
R1393:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R1847:Serpina12 UTSW 12 104032510 missense probably damaging 1.00
R1956:Serpina12 UTSW 12 104035789 missense probably damaging 1.00
R4093:Serpina12 UTSW 12 104037924 missense probably damaging 1.00
R4584:Serpina12 UTSW 12 104038352 missense unknown
R4897:Serpina12 UTSW 12 104037797 missense possibly damaging 0.60
R5117:Serpina12 UTSW 12 104037750 missense possibly damaging 0.73
R5167:Serpina12 UTSW 12 104037920 missense probably damaging 1.00
R5344:Serpina12 UTSW 12 104035548 splice site probably null
R5720:Serpina12 UTSW 12 104038304 missense probably benign 0.05
R6011:Serpina12 UTSW 12 104035734 missense probably damaging 1.00
R6027:Serpina12 UTSW 12 104031077 missense probably benign 0.01
R6170:Serpina12 UTSW 12 104038241 missense probably benign 0.03
R7538:Serpina12 UTSW 12 104038328 missense unknown
R7899:Serpina12 UTSW 12 104038265 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGAGAATCATCACGGTGCC -3'
(R):5'- TCAAGCTACTGCAGAGGCTG -3'

Sequencing Primer
(F):5'- AATCATCACGGTGCCTGGGTC -3'
(R):5'- GGCCAGCAATAGCCCTCAG -3'
Posted On2015-02-05