Incidental Mutation 'R5720:Gm11595'
ID451418
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission 043188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5720 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,203,687 N1165K probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
BC037034 A G 5: 138,263,702 V44A probably benign Het
Cdh23 T C 10: 60,393,023 T1125A possibly damaging Het
Ctf1 A T 7: 127,717,002 probably null Het
Defb26 T C 2: 152,508,202 N53D possibly damaging Het
Dhtkd1 T C 2: 5,903,014 T787A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxl7 A G 15: 26,552,893 L96P probably damaging Het
Gpr65 A T 12: 98,275,102 S5C probably damaging Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Itga8 G A 2: 12,111,087 S76L probably damaging Het
Mpdz A T 4: 81,287,694 F1810Y probably damaging Het
Nfrkb T C 9: 31,394,742 L126P probably damaging Het
Olfr1250 T C 2: 89,656,955 Y162C probably benign Het
Primpol A G 8: 46,581,642 V417A probably damaging Het
Pus1 C T 5: 110,777,718 E79K probably damaging Het
Rspo2 C T 15: 43,169,814 C4Y probably benign Het
Serpina12 T C 12: 104,038,304 D23G probably benign Het
Serpind1 A T 16: 17,339,832 R297S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc17a6 C T 7: 51,625,397 P68L probably damaging Het
Slc6a5 C T 7: 49,956,516 P724L possibly damaging Het
Spaca7 A G 8: 12,599,004 E166G possibly damaging Het
Supt5 A G 7: 28,322,568 S345P probably damaging Het
Syne2 G A 12: 75,967,667 D3211N probably benign Het
Tmem132e G A 11: 82,442,450 probably null Het
Zfp384 T C 6: 125,036,624 S536P probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2017-01-03