Mutagenetix > Incidental Mutation

Incidental Mutation 'R5859:Ncbp1'

455048

Institutional Source

Beutler Lab

Gene Symbol

Ncbp1

Ensembl Gene

ENSMUSG00000028330

Gene Name

nuclear cap binding protein subunit 1

Synonyms

MMRRC Submission

044071-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5859 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46138613-46172403 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46163026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 480 (N480S)

Ref Sequence

ENSEMBL: ENSMUSP00000030014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030014] [ENSMUST00000058232]

AlphaFold

Q3UYV9

PDB Structure

Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000030014
AA Change: N480S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: N480S

Domain	Start	End	E-Value	Type
MIF4G	28	240	1.33e-38	SMART
Pfam:MIF4G_like	309	471	1.4e-37	PFAM
Pfam:MIF4G_like_2	485	754	4e-78	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000058232

SMART Domains

Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329

Domain	Start	End	E-Value	Type
low complexity region	32	55	N/A	INTRINSIC
Pfam:XPA_N	101	132	5.2e-18	PFAM
Pfam:XPA_C	134	185	3e-30	PFAM
low complexity region	212	223	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131187

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133286

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

93% (70/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	A	T	8: 24,813,461	V150E	probably benign	Het
Alg11	A	G	8: 22,065,841	K373E	probably benign	Het
Arl14ep	C	T	2: 106,969,053		probably benign	Het
Ascc2	G	A	11: 4,658,284	G227R	probably benign	Het
Ash1l	C	T	3: 89,068,993	P2627S	probably damaging	Het
Btla	T	G	16: 45,239,039		probably null	Het
Btnl10	C	T	11: 58,922,312	P256S	probably benign	Het
Cep162	C	T	9: 87,204,092	A1060T	probably damaging	Het
Cfap54	T	A	10: 93,016,524	K907*	probably null	Het
Chpf	A	T	1: 75,475,428	F461I	probably damaging	Het
Chrdl2	A	G	7: 100,020,907	Y79C	probably damaging	Het
Copb2	G	A	9: 98,568,108	C40Y	probably benign	Het
Cyfip1	T	C	7: 55,925,181	L1060P	probably damaging	Het
Drg1	G	A	11: 3,259,273		probably benign	Het
Erich3	A	G	3: 154,762,497	D862G	possibly damaging	Het
Flii	G	T	11: 60,716,311	Y946*	probably null	Het
Glt8d2	T	C	10: 82,672,081	M1V	probably null	Het
Gm21136	T	A	7: 38,867,741		noncoding transcript	Het
Gramd1c	T	C	16: 43,992,091	T393A	possibly damaging	Het
Gucy2d	T	A	7: 98,451,883	I471N	probably benign	Het
Hps3	G	A	3: 20,008,870	T711M	probably benign	Het
Hs3st4	A	T	7: 123,983,608	D143V	probably benign	Het
Kif17	T	A	4: 138,291,433	M461K	possibly damaging	Het
Klhdc7a	T	A	4: 139,967,574	S21C	probably damaging	Het
Klk15	G	A	7: 43,938,376	R76H	probably benign	Het
Lnpk	G	A	2: 74,569,028	T57I	possibly damaging	Het
Ltbp2	A	G	12: 84,794,063	V999A	possibly damaging	Het
Ltbr	T	C	6: 125,312,808	H141R	probably damaging	Het
Lvrn	T	C	18: 46,893,749	F805L	probably damaging	Het
Ms4a13	A	T	19: 11,183,916	C86*	probably null	Het
Nelfcd	T	G	2: 174,427,063	*592G	probably null	Het
Neurog2	T	C	3: 127,634,015	V96A	probably benign	Het
Nod1	A	T	6: 54,930,177	W902R	probably benign	Het
Olfr103	T	C	17: 37,336,369	I288V	possibly damaging	Het
Olfr213	T	C	6: 116,540,900	L149P	probably damaging	Het
Olfr543	T	C	7: 102,477,750	Y40C	possibly damaging	Het
Olfr726	T	A	14: 50,084,027	Y218F	probably damaging	Het
Pcdha11	A	T	18: 37,007,283	H655L	probably damaging	Het
Plpp7	A	G	2: 32,095,984	E58G	probably benign	Het
Psph	A	T	5: 129,790,621		probably benign	Het
Rab11fip1	A	C	8: 27,154,720	S346A	probably damaging	Het
Rreb1	C	A	13: 37,947,408	P1513T	probably benign	Het
Rreb1	C	T	13: 37,947,409	P1513L	probably benign	Het
Rsf1	C	T	7: 97,685,559	R1300C	probably damaging	Het
Scap	A	G	9: 110,374,047	N263S	probably benign	Het
Sec24d	A	T	3: 123,279,312		probably benign	Het
Slain2	T	C	5: 72,948,545		probably benign	Het
Slc6a18	G	T	13: 73,668,159	T367N	probably benign	Het
Slk	T	A	19: 47,609,042	D96E	probably benign	Het
Spag5	G	A	11: 78,313,534	V514I	probably benign	Het
St8sia2	T	C	7: 73,966,906	D107G	probably damaging	Het
Tgfbr3	T	A	5: 107,140,515	I427F	probably benign	Het
Tlr2	T	G	3: 83,836,503	T758P	possibly damaging	Het
Tmem270	A	G	5: 134,902,884	V68A	probably benign	Het
Vmn2r106	T	A	17: 20,285,321	H37L	possibly damaging	Het
Vmn2r27	T	G	6: 124,200,688	R452S	probably damaging	Het
Wdr5	A	G	2: 27,533,350	Y252C	probably damaging	Het
Zswim9	C	T	7: 13,261,445	V262M	probably damaging	Het

Other mutations in Ncbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00840:Ncbp1	APN	4	46161307	missense	probably damaging	1.00
IGL02085:Ncbp1	APN	4	46159699	missense	probably damaging	0.96
IGL02230:Ncbp1	APN	4	46165272	missense	probably benign	0.03
IGL02561:Ncbp1	APN	4	46159711	missense	possibly damaging	0.80
IGL02574:Ncbp1	APN	4	46168449	critical splice acceptor site	probably null
IGL03371:Ncbp1	APN	4	46171991	nonsense	probably null
R0549:Ncbp1	UTSW	4	46168476	missense	possibly damaging	0.69
R0594:Ncbp1	UTSW	4	46170551	missense	probably benign	0.00
R0699:Ncbp1	UTSW	4	46147528	missense	probably benign	0.17
R0725:Ncbp1	UTSW	4	46152056	missense	probably benign	0.01
R0961:Ncbp1	UTSW	4	46165193	missense	possibly damaging	0.69
R1330:Ncbp1	UTSW	4	46167354	missense	probably benign	0.19
R1622:Ncbp1	UTSW	4	46171963	missense	possibly damaging	0.60
R1756:Ncbp1	UTSW	4	46169131	nonsense	probably null
R2417:Ncbp1	UTSW	4	46168530	missense	probably benign	0.20
R4050:Ncbp1	UTSW	4	46147483	missense	probably damaging	0.99
R4132:Ncbp1	UTSW	4	46169241	nonsense	probably null
R4516:Ncbp1	UTSW	4	46157824	missense	probably damaging	1.00
R4795:Ncbp1	UTSW	4	46152967	missense	possibly damaging	0.83
R4796:Ncbp1	UTSW	4	46152967	missense	possibly damaging	0.83
R4960:Ncbp1	UTSW	4	46165273	nonsense	probably null
R5557:Ncbp1	UTSW	4	46165259	missense	probably benign	0.01
R5626:Ncbp1	UTSW	4	46161290	missense	probably damaging	1.00
R5682:Ncbp1	UTSW	4	46170474	unclassified	probably benign
R6377:Ncbp1	UTSW	4	46150703	missense	probably damaging	1.00
R6440:Ncbp1	UTSW	4	46147516	missense	probably damaging	1.00
R6793:Ncbp1	UTSW	4	46157827	missense	probably damaging	0.99
R7078:Ncbp1	UTSW	4	46155756	missense	probably benign	0.00
R7434:Ncbp1	UTSW	4	46149910	missense	probably damaging	1.00
R7445:Ncbp1	UTSW	4	46149914	missense	probably damaging	0.98
R7477:Ncbp1	UTSW	4	46157897	missense	probably damaging	1.00
R7670:Ncbp1	UTSW	4	46170015	missense	probably damaging	0.96
R8424:Ncbp1	UTSW	4	46144839	missense	probably benign
R8970:Ncbp1	UTSW	4	46170023	missense	probably damaging	0.99
R9712:Ncbp1	UTSW	4	46144837	missense	probably benign	0.03
X0013:Ncbp1	UTSW	4	46150702	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCCTCTTAGTTGTTCACTGAG -3'
(R):5'- ACATTCCAGGAAAGAAGTCCTC -3'

Sequencing Primer
(F):5'- CACTGAGTTTGGGATCTTGGATTC -3'
(R):5'- TTCCAGGAAAGAAGTCCTCTTACTAC -3'

Posted On

2017-02-10