Incidental Mutation 'R5064:Vta1'
ID459864
Institutional Source Beutler Lab
Gene Symbol Vta1
Ensembl Gene ENSMUSG00000019868
Gene Namevesicle (multivesicular body) trafficking 1
Synonyms
MMRRC Submission 042654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R5064 (G1)
Quality Score204
Status Validated
Chromosome10
Chromosomal Location14654755-14705560 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 14705478 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020018] [ENSMUST00000154132] [ENSMUST00000190114] [ENSMUST00000191238]
Predicted Effect probably benign
Transcript: ENSMUST00000020018
Predicted Effect probably benign
Transcript: ENSMUST00000149485
SMART Domains Protein: ENSMUSP00000118498
Gene: ENSMUSG00000019868

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Vta1 16 158 2.2e-50 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 184 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151805
Predicted Effect probably benign
Transcript: ENSMUST00000154132
SMART Domains Protein: ENSMUSP00000119829
Gene: ENSMUSG00000019868

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Vta1 16 158 1.6e-53 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 184 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188021
Predicted Effect probably benign
Transcript: ENSMUST00000190114
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C6ORF55 encodes a protein involved in trafficking of the multivesicular body, an endosomal compartment involved in sorting membrane proteins for degradation in lysosomes (Ward et al., 2005 [PubMed 15644320]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,655 noncoding transcript Het
Abca12 A G 1: 71,300,960 V1082A probably damaging Het
Adamts7 T A 9: 90,195,830 Y1496N probably damaging Het
Ascl2 T C 7: 142,968,259 N151D possibly damaging Het
Asxl3 G T 18: 22,516,019 S355I probably benign Het
Cttnbp2 T C 6: 18,448,279 Q127R probably damaging Het
Efhc1 T A 1: 20,974,963 I401N possibly damaging Het
Eml6 C T 11: 29,749,300 V1818I probably benign Het
Fam129a A G 1: 151,689,659 I247V probably benign Het
Grin1 G T 2: 25,303,831 probably benign Het
Ints2 C T 11: 86,249,274 R244H probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mllt6 C A 11: 97,673,949 A527E probably damaging Het
Msh5 G T 17: 35,043,783 probably benign Het
Mypn T A 10: 63,123,371 D1057V possibly damaging Het
Nasp A G 4: 116,611,970 probably null Het
Nat8l T C 5: 33,996,869 V9A probably damaging Het
Nr1h2 G A 7: 44,551,649 A219V possibly damaging Het
Nup155 C A 15: 8,135,870 H663Q probably damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Plppr1 A T 4: 49,319,974 H200L probably benign Het
Por T C 5: 135,733,795 V421A probably benign Het
Pxylp1 T G 9: 96,854,800 probably benign Het
Serpina3a G A 12: 104,116,189 V74I probably benign Het
Sfxn1 T C 13: 54,085,569 I37T probably benign Het
Thsd7a G T 6: 12,330,952 T1397N possibly damaging Het
Tnrc6a T C 7: 123,186,723 probably null Het
Vmn1r55 A T 7: 5,146,929 M165K probably benign Het
Vmn2r58 A T 7: 41,837,110 M787K probably damaging Het
Zfp236 A G 18: 82,691,576 probably null Het
Other mutations in Vta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Vta1 APN 10 14684131 missense probably damaging 0.98
IGL02331:Vta1 APN 10 14705394 missense probably damaging 1.00
IGL03161:Vta1 APN 10 14667972 missense possibly damaging 0.54
R2680:Vta1 UTSW 10 14705427 unclassified probably benign
R4751:Vta1 UTSW 10 14655816 missense probably benign 0.03
R5288:Vta1 UTSW 10 14705399 missense probably damaging 0.98
R5635:Vta1 UTSW 10 14668122 splice site probably null
R6146:Vta1 UTSW 10 14705352 missense probably damaging 1.00
R7853:Vta1 UTSW 10 14655717 missense probably damaging 0.96
R7936:Vta1 UTSW 10 14655717 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAAGGCTCAGGTCTGAAGC -3'
(R):5'- CGACACAGGAGACTCTCATTCTC -3'

Sequencing Primer
(F):5'- TCAGGTCTGAAGCCAGGG -3'
(R):5'- TCTCATTCTCCAAATAATAACTGCC -3'
Posted On2017-02-27