Incidental Mutation 'R6105:Pak1ip1'
ID485482
Institutional Source Beutler Lab
Gene Symbol Pak1ip1
Ensembl Gene ENSMUSG00000038683
Gene NamePAK1 interacting protein 1
Synonyms5830431I15Rik, Gdpd1, 5930415H02Rik, p21-activated protein kinase-interacting protein 1, PIP1
MMRRC Submission 044255-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6105 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location41001023-41013015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41004885 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 78 (L78Q)
Ref Sequence ENSEMBL: ENSMUSP00000040846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046951]
Predicted Effect probably damaging
Transcript: ENSMUST00000046951
AA Change: L78Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040846
Gene: ENSMUSG00000038683
AA Change: L78Q

DomainStartEndE-ValueType
WD40 29 68 6.89e-3 SMART
WD40 71 109 1.19e-6 SMART
WD40 112 151 1.59e-7 SMART
Blast:WD40 156 190 4e-10 BLAST
WD40 194 231 3.45e-1 SMART
WD40 234 275 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174551
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutagenesis exhibit median orofacial clefting, developmental delay and death around E14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,397,812 M3555T probably damaging Het
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Ipo8 A G 6: 148,798,670 Y570H probably damaging Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mtmr3 T C 11: 4,485,432 D1116G probably damaging Het
Olfr1198 T A 2: 88,746,840 H16L probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Phf10 C T 17: 14,954,125 probably null Het
Pikfyve A G 1: 65,264,345 probably null Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Postn A G 3: 54,372,220 probably null Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Sult4a1 T A 15: 84,086,620 K195* probably null Het
Tgfb1i1 T A 7: 128,248,417 probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trappc8 A G 18: 20,846,447 probably null Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Vmn2r19 A C 6: 123,316,095 E365D possibly damaging Het
Vps18 A G 2: 119,289,062 Y8C probably damaging Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp111 T C 7: 24,203,366 probably null Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Pak1ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Pak1ip1 APN 13 41008018 missense possibly damaging 0.66
IGL00848:Pak1ip1 APN 13 41012623 missense probably benign 0.18
IGL02327:Pak1ip1 APN 13 41012417 missense probably benign
R0383:Pak1ip1 UTSW 13 41012604 missense probably benign 0.00
R1706:Pak1ip1 UTSW 13 41012688 missense probably benign 0.00
R1851:Pak1ip1 UTSW 13 41011232 missense possibly damaging 0.90
R1852:Pak1ip1 UTSW 13 41011232 missense possibly damaging 0.90
R4255:Pak1ip1 UTSW 13 41011156 intron probably benign
R4326:Pak1ip1 UTSW 13 41004756 missense possibly damaging 0.82
R5062:Pak1ip1 UTSW 13 41008145 splice site probably benign
R5929:Pak1ip1 UTSW 13 41004800 missense probably benign 0.42
R6101:Pak1ip1 UTSW 13 41004885 missense probably damaging 1.00
R6198:Pak1ip1 UTSW 13 41001410 missense probably benign
R7179:Pak1ip1 UTSW 13 41009542 missense probably damaging 0.97
R7367:Pak1ip1 UTSW 13 41008895 missense probably damaging 1.00
R7487:Pak1ip1 UTSW 13 41009255 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGACGATGTCCCCTTCC -3'
(R):5'- GGAGGATGAAAAGTCCCTGTG -3'

Sequencing Primer
(F):5'- CTTCTCAGACATGGACTCCTGTGG -3'
(R):5'- TTAGTTGCACACATGGGACC -3'
Posted On2017-08-16