Incidental Mutation 'R6157:Olfr640'
ID489646
Institutional Source Beutler Lab
Gene Symbol Olfr640
Ensembl Gene ENSMUSG00000066262
Gene Nameolfactory receptor 640
SynonymsGA_x6K02T2PBJ9-6756759-6755815, MOR13-4
MMRRC Submission 044304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6157 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104018686-104025573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104021898 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 140 (N140I)
Ref Sequence ENSEMBL: ENSMUSP00000151356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084799] [ENSMUST00000138055] [ENSMUST00000215653] [ENSMUST00000218535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084799
AA Change: N140I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081858
Gene: ENSMUSG00000066262
AA Change: N140I

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.7e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.9e-8 PFAM
Pfam:7tm_1 43 294 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215653
Predicted Effect possibly damaging
Transcript: ENSMUST00000218535
AA Change: N140I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,063,416 K505E possibly damaging Het
Abcb1b A T 5: 8,824,245 N390I possibly damaging Het
Apob A T 12: 8,006,077 M1520L probably benign Het
Atg4c C T 4: 99,235,163 R396* probably null Het
Atp2a3 G A 11: 72,980,616 V648M probably damaging Het
Blm T C 7: 80,512,985 D203G probably benign Het
Csrnp3 A T 2: 65,949,019 D13V probably damaging Het
Dnajc10 A T 2: 80,317,391 probably benign Het
Dst A G 1: 34,211,172 Y1729C probably damaging Het
Ecsit T C 9: 22,074,691 Y213C probably damaging Het
Fer A G 17: 64,078,885 K654R probably damaging Het
Hdac9 G T 12: 34,389,429 A383E probably damaging Het
Hltf T A 3: 20,076,496 S293T probably benign Het
Hrasls A G 16: 29,217,749 I46M possibly damaging Het
Hydin T A 8: 110,528,016 D2359E probably benign Het
Inf2 A G 12: 112,604,788 probably benign Het
Kcns2 A G 15: 34,839,358 N289S possibly damaging Het
Meioc T C 11: 102,668,401 S50P probably damaging Het
Mocs1 G T 17: 49,454,736 E619D probably benign Het
Nfatc2 A G 2: 168,519,451 probably benign Het
Pag1 A T 3: 9,693,836 H407Q probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pld4 C T 12: 112,768,101 T432I probably damaging Het
Psd3 T G 8: 68,121,527 M1L probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Ripor2 T C 13: 24,701,069 L390P probably damaging Het
Rpgrip1 A T 14: 52,112,174 E6D probably benign Het
Ryr3 A T 2: 112,841,899 L1409Q probably damaging Het
Slc6a5 A G 7: 49,951,502 T684A probably benign Het
Smpd4 G T 16: 17,641,066 probably null Het
Snx18 T C 13: 113,617,189 S403G probably damaging Het
Spsb4 G T 9: 96,996,107 H54Q probably damaging Het
Ssrp1 A G 2: 85,040,728 Y236C probably damaging Het
Tctex1d2 G A 16: 32,419,842 A12T possibly damaging Het
Tenm3 C T 8: 48,298,808 S982N probably damaging Het
Tet1 A G 10: 62,839,970 S776P probably damaging Het
Tln1 G A 4: 43,534,744 P2166S probably benign Het
Ufl1 T A 4: 25,279,350 Q83L possibly damaging Het
Unc80 A T 1: 66,654,029 K2458* probably null Het
Ush2a A T 1: 188,728,270 Y2576F probably benign Het
Xrcc6 C A 15: 82,029,104 probably null Het
Zbtb48 A G 4: 152,021,607 F380L probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Olfr640
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Olfr640 APN 7 104022104 unclassified probably null
IGL02552:Olfr640 APN 7 104022256 missense probably damaging 1.00
IGL03084:Olfr640 APN 7 104021631 missense probably benign
R0470:Olfr640 UTSW 7 104021670 missense probably damaging 1.00
R0617:Olfr640 UTSW 7 104021989 missense probably damaging 1.00
R1645:Olfr640 UTSW 7 104022003 missense probably damaging 1.00
R4946:Olfr640 UTSW 7 104022012 missense probably damaging 1.00
R5329:Olfr640 UTSW 7 104021997 missense probably damaging 1.00
R5756:Olfr640 UTSW 7 104021682 missense probably damaging 1.00
R5804:Olfr640 UTSW 7 104022232 missense probably benign
R7846:Olfr640 UTSW 7 104021529 missense possibly damaging 0.94
R7929:Olfr640 UTSW 7 104021529 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TACCACAAAGAGCCCATAGATATTG -3'
(R):5'- TCTCAATGACTTGGGAGTGTCC -3'

Sequencing Primer
(F):5'- GAGCCCATAGATATTGTTAACATGG -3'
(R):5'- ACACTTCCTACCGTACTTGCTAC -3'
Posted On2017-10-10