Incidental Mutation 'R6168:Olfr52'
ID490233
Institutional Source Beutler Lab
Gene Symbol Olfr52
Ensembl Gene ENSMUSG00000075199
Gene Nameolfactory receptor 52
SynonymsIE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R6168 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86179412-86185683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86181965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 49 (I49V)
Ref Sequence ENSEMBL: ENSMUSP00000097489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099905] [ENSMUST00000215138] [ENSMUST00000215171]
Predicted Effect probably damaging
Transcript: ENSMUST00000099905
AA Change: I49V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097489
Gene: ENSMUSG00000075199
AA Change: I49V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-56 PFAM
Pfam:7tm_1 41 290 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215138
AA Change: I49V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215739
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
Rhov T C 2: 119,270,972 Y51C probably damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Olfr52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Olfr52 APN 2 86181595 unclassified probably null
R0422:Olfr52 UTSW 2 86181222 missense probably benign 0.00
R0688:Olfr52 UTSW 2 86181605 unclassified probably null
R0976:Olfr52 UTSW 2 86181808 missense probably damaging 0.99
R1240:Olfr52 UTSW 2 86182109 start codon destroyed possibly damaging 0.94
R1316:Olfr52 UTSW 2 86181365 missense probably benign 0.01
R1865:Olfr52 UTSW 2 86181538 missense probably damaging 1.00
R2188:Olfr52 UTSW 2 86181436 missense probably damaging 1.00
R4072:Olfr52 UTSW 2 86181647 missense probably benign 0.02
R4222:Olfr52 UTSW 2 86181997 missense probably damaging 0.99
R5096:Olfr52 UTSW 2 86181932 missense probably damaging 1.00
R5103:Olfr52 UTSW 2 86181616 missense probably benign 0.41
R5934:Olfr52 UTSW 2 86182102 missense probably benign 0.00
R6601:Olfr52 UTSW 2 86181965 missense probably damaging 1.00
R7448:Olfr52 UTSW 2 86181334 missense probably damaging 1.00
R7497:Olfr52 UTSW 2 86182073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGGTTACAAATTGCTGCATATC -3'
(R):5'- CTCCTCCTACAGATGTCCTGAAG -3'

Sequencing Primer
(F):5'- TCTATCATATGCCATGGAAGCCAGG -3'
(R):5'- ATGTCCTGAAGACTCATGGC -3'
Posted On2017-10-10