Incidental Mutation 'R6168:Rhov'
ID490236
Institutional Source Beutler Lab
Gene Symbol Rhov
Ensembl Gene ENSMUSG00000034226
Gene Nameras homolog family member V
SynonymsArhv, A030005A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6168 (G1)
Quality Score139.008
Status Not validated
Chromosome2
Chromosomal Location119269201-119271272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119270972 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 51 (Y51C)
Ref Sequence ENSEMBL: ENSMUSP00000041411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037360]
Predicted Effect probably damaging
Transcript: ENSMUST00000037360
AA Change: Y51C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041411
Gene: ENSMUSG00000034226
AA Change: Y51C

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
RHO 34 208 3.12e-89 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,940 V257A probably benign Het
4932414N04Rik C T 2: 68,741,483 L568F possibly damaging Het
8030462N17Rik A G 18: 77,673,957 S220P probably damaging Het
Adam3 A T 8: 24,681,614 probably null Het
Adamts13 G T 2: 27,004,886 A1069S probably benign Het
Adarb1 A G 10: 77,322,319 L98P probably damaging Het
Ahnak2 T C 12: 112,783,122 E1035G probably benign Het
Alox12b T A 11: 69,169,634 I672N probably damaging Het
Ash1l C T 3: 89,052,773 R2271* probably null Het
Atf7ip A G 6: 136,559,819 T17A probably damaging Het
Col6a5 A G 9: 105,875,787 probably null Het
Crcp A G 5: 130,037,896 N41S probably damaging Het
Defb15 A C 8: 21,930,053 N19K possibly damaging Het
Dnah7a T A 1: 53,411,568 D3901V probably damaging Het
Dnah7b A C 1: 46,290,703 T3236P probably damaging Het
Dnmbp A G 19: 43,850,240 S608P probably damaging Het
Efcab12 T C 6: 115,814,616 K532E probably damaging Het
Fbrsl1 C T 5: 110,396,056 V54M probably damaging Het
Gm14496 T A 2: 182,000,957 V807E probably damaging Het
Hoxa2 A G 6: 52,163,481 L175P probably damaging Het
Igkv4-58 A C 6: 69,500,297 D105E probably damaging Het
Igkv8-27 A T 6: 70,171,896 S91R probably benign Het
Itgax T C 7: 128,133,097 V175A probably damaging Het
Kcnc2 A G 10: 112,455,756 D283G probably benign Het
Lepr G A 4: 101,735,592 G135R probably damaging Het
Mcf2l A G 8: 13,001,823 S378G probably benign Het
Mta1 T A 12: 113,123,119 D145E probably damaging Het
Nkd1 T A 8: 88,585,231 N44K probably damaging Het
Notch2 A G 3: 98,145,217 K2010E probably damaging Het
Nsd3 G A 8: 25,691,161 G930S probably null Het
Olfr1047 T G 2: 86,228,594 I126L probably damaging Het
Olfr263 T G 13: 21,133,229 I151M possibly damaging Het
Olfr52 T C 2: 86,181,965 I49V probably damaging Het
Olfr772 A G 10: 129,174,166 F285S probably damaging Het
Olfr955 A G 9: 39,470,657 L23P probably damaging Het
Pde4c G A 8: 70,750,039 E625K probably benign Het
Pdgfb T C 15: 80,000,386 T151A probably benign Het
Pik3r5 T C 11: 68,492,675 V440A probably benign Het
Piwil2 T C 14: 70,395,351 T591A probably benign Het
Ppm1l A G 3: 69,549,407 D219G probably damaging Het
Psmc6 T C 14: 45,343,683 I312T probably damaging Het
Rasl10a T C 11: 5,058,442 V46A possibly damaging Het
S100a16 C T 3: 90,542,572 Q121* probably null Het
Slc5a12 T C 2: 110,616,744 V199A probably damaging Het
Slc6a7 A T 18: 61,001,662 M447K probably benign Het
Tarbp1 A G 8: 126,448,405 V764A possibly damaging Het
Vmn1r197 T C 13: 22,328,508 Y200H possibly damaging Het
Vmn2r102 G A 17: 19,694,140 A656T possibly damaging Het
Vmn2r49 G T 7: 9,984,786 D450E probably benign Het
Wdr7 T A 18: 63,777,977 N813K probably damaging Het
Yeats2 T C 16: 20,179,558 S288P probably benign Het
Zswim6 G A 13: 107,787,764 noncoding transcript Het
Other mutations in Rhov
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Rhov APN 2 119270738 missense probably benign 0.15
R0732:Rhov UTSW 2 119271014 missense probably damaging 1.00
R1646:Rhov UTSW 2 119271020 missense probably damaging 1.00
R4997:Rhov UTSW 2 119270468 missense probably damaging 1.00
R5124:Rhov UTSW 2 119271087 missense unknown
R5993:Rhov UTSW 2 119270052 missense probably damaging 1.00
Z1177:Rhov UTSW 2 119270415 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTTAGGCACAGCATCCTC -3'
(R):5'- CCCAGCTTGGACAGATTGTC -3'

Sequencing Primer
(F):5'- GCACAGCATCCTCGTCCC -3'
(R):5'- ACAGATTGTCAGCGTCCG -3'
Posted On2017-10-10